DATA & PROTOCOLS » ADIANTUM cDNA PRIMERS
Adiantum cDNA Primers

Primers used for sequencing cDNAs of chloroplast encoded genes in Adiantum capillus-veneris. Primers are named after the gene and given in alphabetical order.

Key:
RT = primer for reverse transcriptase; names with f denote forward PCR primers; r denotes reverse PCR primers and seq denotes sequencing primers

Primer name   NIBB#   Primer sequence   Tm

accD-f 1960 aagaaattggggatttgtttgtt
accD-r1 1961 tggtggcagaagcctttgagtg
accd-r2 1962 cgccaggtgctataagtgttccattc
accD-r3 2011 ggaacgtcccttggtaaatagataa
accD-r4 2012 gaagtggtacaagaacaaattaaac
atpA-f 2057 tgaaaaaggtttcatttttacctctc 60
atpA-r2 2058 tgctatgtggggcttaatca 59
atpA-RT 2056 gagtgttcggctgatgtgtc 59
atpB-f 2123 gcggcgaaataccacatact 60
atpB-r2 2124 tcgattaggagccattacacaa 60
atpB-RT 2125 cccatacctcagaattccaaac 60
atpB-seq1 2126 tgttgcagccttggattgta 60
atpB-seq2 2127 ccgccattgttagagcagtt 60
atpE-f 2121 agttggcaatattgatgaag 60
atpE-r2 2122 gcaccgaattgggaatatca 61
atpE-RT 2120 gcggagcaccgtaacactat 60
atpF-f 1951 tcaattcttgctaggctggatca
atpF-r1 1952 cattgtcagctgcatcaacgagat
atpF-r2 1953 agatctcgccgttccctatc
atpF-r3 2013 caaaaagtattactgcgaaaaggagag
atpF-r4 2014 ttcatgataagatggaggctga
atpH-f 2063 gcaaaatcgactaaagttcctaga
atpH-r2 2064 aattatttcttattcgtcgagatg
atpH-RT 2062 gaggggagggcagacaata
atpI-f 2066 agataattttgttcctcattgtga
atpI-r2 2067 gaaaagagatttcccgcaact
atpI-RT 2065 atagtgacccgccagattgt
ccsA-f 1969 tggtctccctcaattacgacat
ccsA-f2 2018 aaagaataaattactggtctccc
ccsA-r1 1970 tgctagcgaagacccacacaatga
ccsA-r2 1971 cactgagactgcgaagcgggtact
ccsA-r3 2019 cccccaatttctcaatgtagtt
ccsA-r4 2020 ctttttattttccttcaatttgcc
chlB-f 2028 tcctttgattaatcttccagttca 59
chlB-r1 2029 gcattctcaaaatgggattga 60
chlB-r2 2030 tctcgagtaattagcggacta 55
chlL-r2 2264 tgtatacacacaaagatttactctc 53
chlL-RT 2265 ttccttagattagaaaagtgtggatgt 60
chlL-seq1 2266 gcaagggatgggtatgtgat 60
chlN-f 2261 ggatttacatccacacttttct 55
chlN-r2 2262 tctcttcatagtgattcgctacc 58
chlN-RT 2263 aaggaattgagtaaacggagtt 56
clpP-f 2157 acgcccacaattcagaggta 61
clpP-r2 2158 aaaatacatgaaactgcgaagaaa 60
clpP-RT 2159 tgcttctaaaggggtgaatcat 60
infA-f 2185 tttggagaaacctgtaatgtaaa 56
infA-r2 2186 ttttattgggaagctctgttt 56
infA-RT 2187 cccacgtgaacgaatttttct 61
matK-f 1948 tgggagttatcgcgacgaaag
matK-f2 2005 cataccaatgcttgggagttat 58
matK-r1 1949 tgtcgtcggaacaatcgaattgaag
matK-r2 1950 tgtggcaaatccgcttctaaa
matK-r3 2004 gaaacgaaagcaatggaataaaa 60
ndhA-f 2243 tgaaactcgcggatattgtg 60
ndhA-r2 2244 tgggtgccaagttttcttgt 61
ndhA-RT 2245 tttgagcaggtaatttgtgtg 56
ndhB seqX 2343 cgatcttttcgctcattcag
ndhB-f 2034 gaaaaagatggggaaggaaagaga
ndhB-r1 2035 gaaagaaagagggaaaagaagagaga
ndhB-r2 2036 aggaggtttcgtactataatttg
ndhC-f 2117 gcggtaattatcgggaagaa 60
ndhC-r2 2118 cctttgtattcaattttccttatgttc 60
ndhC-RT 2119 cctgaagaggcagctttgac 60
ndhD-f 2231 tgagtcatctcatttggcttaca 59
ndhD-r2 2232 tttgtactaaattctctaggtactca 53
ndhD-RT 2233 tgccatagaggtggtgtacaaa 60
ndhE-f 2237 tcatcaaaatgttcgaggagaa 60
ndhE-r2 2238 ccgagggaaaattcaacaac 59
ndhE-RT 2239 tcaaactaatttgttgaggtgaa 57
ndhF-f 2225 cgtcgggaagtagcaacaa 59
ndhF-r2 2226 aacgcgaattggagtttc 59
ndhF-RT 2227 agaaagatggggaagatgaa 59
ndhG-f 2240 ctgtcgaataaagattaaaaataaa 59
ndhG-r2 2241 ttaaataattctccgtcggttagaa 59
ndhG-RT 2242 tcccggggcttcaatataa 59
ndhH-f 2246 ttgtctcattctcgggtcaa 59
ndhH-r2 2247 tttctgcaaaattcggtact 55
ndhH-RT 2248 ttgatttggaaagattcattgt 56
ndhJ-f 1957 catgaacaccgttgataaagagaa
ndhJ-f2 2006 ttggagggatcagcagaacat 62
ndhJ-r1 1958 agcggccagccaatccaact
ndhJ-r2 1959 tccaaacccaataaaccgaaggta
ndhj-r3 2007 ataggttgggtagaaaaaagt
ndhj-r4 2008 aatactgagtttctccgtttcta
ndhK-f 2115 aatcgtcggcttggtttatg 59
ndhK-RT 2116 tctctttatcaacggtgttcatgt 60
petA-f 2145 cgacctggttgtacaaatattca 59
petA-r2 2146 ttcaaatggtttatctgctgtga 60
petA-RT 2147 tttttcatacacccggtagag 57
petB-f 2168 tttttctttcatttcttcgactact 57
petB-r3 2352 gacccgaaatgccttgttta
petB-RT 2169 ggggtccttttgatgtgatg 60
petD-f 2175 gtcccaaactaccgggataa 59
petD-r2 2176 tgctacaaagcaaatagtccctaga 61
petD-RT 2177 tttttcacccgaaaacagac 58
petD-seq1 2178 gcaaaacaggatcgttcaag 58
petL_G-f 2148 ttatatactaacccatctgctagacaa 57
petL_G-r2 2149 tcccaaaatatcccttttgtt 59
petL_G-RT 2150 ggctttcgccatatatatttttaat 58
petN-f 2037 tttcgtctgaccggctgaac 63
petN-f2 2346 tggggagtgaaaagataggaatta
petN-r2 2038 ggatccgtttaacgaaggatcaa 63
petN-r3 2347 agctactcgacacaagtcacaa
petN-RT 2170 tgcagtgtaatttaattcctaaa 54
psaA-f 2105 aatgaaacccccaattctca 59
psaA-r2 2106 ttggaaatcttgataccataatgttt 59
psaA-RT 2107 gggatagaccctggctgaac 61
psaA-seq1 2108 cccttcctcacgaactcatc 60
psaA-seq2 2109 agctcgccatagttggaaga 59
psaA-seq3 2110 ctaattgagcgtgccatgaa 60
psaB-f 2102 ccacaacttgggcattcttc 60
psaB-r2 2103 gtaaatctgacgcgggaaca 61
psaB-RT 2104 acaagtaggcagtcggtgtg 59
psaC-f 2234 taggaattcaccatattgatttaaga 57
psaC-r2 2235 ttttgggtatgagttgaaatga 57
psaC-r3 2416 ggattaacttttcagtcctacct
psaC-RT 2236 gactcatacccaactttggaagtc 60
psaI-f 2137 cggaaatacgttgccgtataa 60
psaI-f2 2411 gaggcaatttcaccatgaca
psaI-r2 2136 gtggcagacccactttcagt 60
psaI-r3 2412 cgggagaagattacaggatttc
psaI-RT 2138 aggtaatttactttgtaggaagag 53
psaJ-f 2151 tgaggataaaggcaagtaggtagg 60
psaJ-r2 2152 cctacacggctcctttggttta 62
psaJ-RT 2153 tgacgaaccatagagttctcactt 59
psbA-f 2209 gcttactagcctggggaatca 60
psbA-r2 2210 atccagctgtgctgcctaac 60
psbA-RT 2211 atatcttcttaaattgaagggtttg 56
psbA-seq1 2212 gtatgcctctgggcatttct 59
psbB-f 2009 tattatattgcaagaaagttacgc 55
psbC-f 1954 tggatggcagctcaggatcag
psbC-f2 2023 cccgagttcgagactttctacaca 64
psbC-r1 1955 ccagtaggaaagcgccgaaac
psbC-r2 1956 tcgggaccaatcaaagcatga
psbC-r3 2024 gaggaggcaaatttattaagtcctcac 63
psbC-r4 2025 ttctgccatcaccctttcatca 65
psbD-f 2086 ttgggtagcttagtgggaaca 60
psbD-r2 2085 accacccagcgagagagtt 60
psbD-RT 2087 aaaacccgtggtttcctgat 61
psbE_J-f 2039 tcttccctcgacccctttgac 65
psbE_J-r1 2040 gcaggggaaaaggtaggtgttg 64
psbE_J-r2 2041 actgacttacacctccacaaa 64
psbI-f 2051 ttctttccttttattttatcaccttta 57
psbI-f2 2408 gagttacatcatgcttaccctcaa
psbI-r2 2050 tgccatcgataaaaatgaagtg 60
psbI-RT 2052 ctcaattggctaaattgatgt 55
psbK-f 2047 tcacatgttccataactggagag 59
psbK-r2 2049 gaatctggattcaaccgatctt 59
psbK-RT 2048 gagctattggagaagtgttgagaa 59
psbM-f 2080 tctcgataggaccgctcaat 60
psbM-r2 2081 ccaagaaatctactaagttaccaatca 58
psbM-RT ccccagctacccccataaat 62
psbN-f 2163 gttgaaatttgctgactttgt 55
psbN-f2 2341 tggtaattaaaatctattgggtcat
psbN-r2 2164 tggagaccttcttctccaattta 59
psbN-r3 2342 tggagaggaaggtctccaatta
psbN-RT 2165 ttgtcgagacaaggaaaataaga 58
psB-r2 2010 atcgagttcgacgggatctg 63
psbT-f 2160 aattctactggagtgatacctactaa 54
psbT-r2 2161 caagtccccagctgttgttt 60
psbT-RT 2162 cctcttcgattttcgatgtctc 60
psbZ-f 2082 ttcctcatgcgaaaggaatc 60
psbZ-r2 2083 cggtaagttacgaggggaaga 60
psbZ-RT 2084 gaaaatctatttatctcgtctcaca 56
rbcL-f 2129 ctctacctatgccgagcagat 60
rbcL-f2 2390 caaactcatgtcgccacaaa
rbcL-r2 2128 tttccggacaggtgctagag 60
rbcL-r3 2391 gaaatttggcaatttgcactt
rbcL-RT 2130 tcctagtatgtctcataatcatttctc 60
rbcL-seq1 2131 ggcctgggatttgaagagag 60
rbcL-seq2 2132 atgtccggtggagatcacat 60
rbcL-seq3 2133 ttgaggaaggttccgtcacta 60
ropB-RT 2079 ttcgatgaatcataataaactctcaa 58
ropC1-r2 2074 ccctcacccattgcctataa 58
rpl14-f 2188 cggatagatagagctatgctaataaa 57
rpl14-r2 2189 ttctaagaaatgaaacgagctttct 59
rpl14-RT 2190 cccaaatttttaaacgaattgaag 60
rpl16-f 2191 aaccctccttttgttgatcagt 59
rpl16-f2 2414 ttcaataaacaagccctcaa
rpl16-r2 2192 tcggaaatatcctcctattgtctt 59
rpl16-r3 2351 ccccactgatttagatggaaag
rpl16-r4 2415 ggtcacaatttttccgaagtt
rpl16-RT 2193 aaattgcaggtattgtgtgttg 58
rpl20-f 1963 atctgagatttttgtgaggctat
rpl20-r1 1964 ggcatctggagtagcgatttgag
rpl20-r2 1965 ccgaactgtgggtaattccatctc
rpl20-r3 2026 tggaatttggtttattcgcctctc 65
rpl20-r4 2027 actttaccgccgcggatcat 66
rpl21-f 2228 ttgtaaaatttggaaacgaatcaa 60
rpl21-r2 2229 tcaaacaactacccgggaata 59
rpl21-RT 2230 tttttaactgtttgttcactcttct 56
rpl22-f 2200 acttcgtcgacgcaaaagtt 60
rpl22-r2 2201 tttcattcatatgcgatcacttg 60
rpl22-RT 2202 ttctcttgtagctctttcttgctac 58
rpl23-f 2206 cgagaagtgggaaacaaagtg 59
rpl23-r2 2207 ttctttctttctgggggaatc 60
rpl23-RT 2208 ttctcccctcccccaact 62
rpl23-seq1 2389 actatttgtaccttccaccttgac
rpl2-f 2203 ggggaggggagaaaagtaaa 60
rpl2-r2 2204 cgtgaacagttactcctttcctaat 59
rpl2-RT 2205 caaagggacctctttttgatg 59
rpl33-f 2154 cccctctttttggggaaact 62
rpl33-r2 2155 ctcatttgataagttaaagaatctg 54
rpl33-RT 2156 gcatctgtttcgcggtaaat 60
rpoA-f 2179 cgtctaactagtgattagtcacatcaa 58
rpoA-r2 2180 tggtttgataagggaaatagt 59
rpoA-RT 2181 gacttccaaaacttctaatacgtaaa 56
rpoB-f 2077 gatgtatcacttcgttaggaggaa 59
rpoB-r2 2078 tttcacgagagaaatttcaagga 60
rpoC1-f 2075 gggaagggaatttgaaaaca 59
rpoC1-r3 2348 aaaaagctttatcattcctcattatt
rpoC1-RT 2076 ctcaatttcattaaactgattc 61
rpoC2-f 2072 gagcttgctaaatactgcgatataaa 59
rpoC2-r2 2071 atcatttcgcggtttgaaat 59
rpoC2-r3 2173 gacgagcgatattgcagatg 59
rpoC2-RT 2073 ggtaaattgttacaatccagtg 54
rpoC2-RT3 2174 ggatggagatcccgaaaga 59
rps11-f 2182 aaatcgagaaaaattcgttca 57
rps11-r2 2183 tttcccctccttttgatgtg 57
rps11-RT 2184 ccactgaattgcctgcttaga 60
rps12-f 2044 gaatctttcaaaccggatcaa 61
rps12-r1 2045 tggtcaatctttgcagtagc 61
rps12-r2 2046 ttgggtcggctacacattta 61
rps14-f 2099 cacaccgactgcctacttgt 60
rps14-r2 2100 tcaattctctaaacaagcggtagata 58
rps14-RT 2101 ctatttatctatcgataaatagataag 49
rps15-f 2249 ggggacgaagttgtgcttac 59
rps15-r2 2250 cctggaggaggcaaaaagat 60
rps15-RT 2251 tgagacaactgctccaattacaa 59
rps16-f 2042 tgatgcctaatcgggaggta 60
rps16-f2 2349 tgagaaattgtcggtccttaga
rps16-r2 2043 ccccaattatcagagcgtttc 61
rps16-r3 2350 gaaatttgtctttactgcgttca
rps2-f 2070 aatgagacaaattcacatccgtttt 62
rps2-r2 2068 cggtgtatagttaaccgcctttc 58
rps2-RT 2069 ttgggtatttcgttgcaaatc 60
rps3-f 2194 agcaagaaagagctacaagagaa 59
rps3-r2 2195 aaactaaccggtttgcattga 59
rps3-RT 2196 ttggaataaaaataattgaaggtgaa 60
rps4-f 2113 aaggagtttttacgtctcggtatc 59
rps4-r2 2114 ctacaaagtatttgattgaatcg 55
rps4-RT 2112 aacttgcatcattcggagtttt 59
rps7-f 2015 gacgtagttgtaaactcgtggta
rps7-r2 2017 ccccgattccaatccacaac
rps8-f 1966 acaattctaataattaccga
rps8-r1 1967 tcttcgcctagcttcccgatct
rps8-r2 1968 tgagaccgggtttgctaatgtacc
rps8-r3 2021 ttcattgaaaacgtaactggtgaa
rps8-r4 2022 aacttttgtttctgtttctccc
rps-f2 2016 caccgccgggaaaagacata
rrn16-f 2277 tccattcagctttctctgtgtc 59
rrn16-r2 2278 tcaaggttcgaaatggacaa 59
rrn16-RT 2279 ggattccattcggaagatga 59
rrn23-f1 2270 gcatcgcaggtggagtagc 62
rrn23-f2 2273 agaggcgtagttgatggacaa 59
rrn23-r1 2271 ggaccaacaaggggcagta 59
rrn23-r2 2274 caaagcctcccaaggaagta 59
rrn23-RT1 2272 gataaccacctttcggctaac 58
rrn23-RT2 2275 ggagacttttgttgcgtttc 57
rrn23-seq1 2276 ggatgaagcttgggtgaaac 60
rrn5-f 2267 gcgaaacgcaacaaaagtct 60
rrn5-r2 2268 aaatcccgcgagaacaaa 59
rrn5-RT 2269 cgctaaatgtagttccgcatatc 60
trnA-f 2283 gcatctggtcagttcacgtatg 61
trnA-f2 2394 aagcacaggggatatagctcag
trnA-r2 2284 gtgtgagattccatcgacttg 60
trnA-r3 2395 aggttggagataagcggactc
trnA-RT 2285 accggcgtatcaagcttct 60
trnC-r3 2344 caaattgttattttccatttcttcttc
trnC-RT 2345 cctagatgggtgagtaaaattagatga
trnE-f 2292 gcatccttaatccctccatatt 59
trnE-f2 2404 agataatctggcccccatcgtcta
trnE-r2 2293 tgtgcgcaaagaagttattga 56
trnE-r3 2405 tgtgcgcaaagaagttattga
trnE-RT 2294 aatttaccgggaggggtaac 59
trnG-f 2286 cattgtgcaattaatctctct 52
trnG-f2 2406 aagtttgtatcgtagcgggtat
trnG-r2 2287 tgggatgcactagtaaataggagaa 59
trnG-r3 2407 ggcataattagcagcgggtag
trnG-RT 2288 gaatataaggtttggctcgaatg 59
trnI-f 2280 ggattcccccgcttcatt 62
trnI-f2 2392 ggacctgcataatgggctat
trnI-r2 2281 ccagatgcttcttccgattt 59
trnI-r3 2393 cgaaactgggccatcctgggtt
trnI-RT 2282 tatcccctgtgcttggtaca 50
trnL-f 2295 tttcgataatgaggaaatatcta 53
trnL-r2 2296 caatcggatttgatgctaatga 60
trnL-RT 2297 aaacaagcgggtttaaattgat 59
trnR-f 2289 ccaacattgaaaatcggaaag 59
trnR-f2 2354 ggggatacgtccatcgtcta
trnR-r2 2290 gacacatcagccgaacactc 59
trnR-r3 2353 ctcctgcattagggttattatca
trnR-RT 2291 ccccacatagcatagcacag 59
trnsec-f 2031 gcacctgtccggaaagagaaa
trnSec-f2 2400 ccaagttaggttggtggctaaa
trnsec-r1 2033 gagtaaaacaatatattggaaatcat
trnsec-r2 2032 tgaaattggatgaccaagtaaatca
trnSec-r3 2401 ttattctctctcatttttgatatg
trnT-f 2304 tcttcttgcacccagaatca 59
trnT-f2 2396 aaatgatccctcgtctattccg
trnT-r2 2305 caaggggtcgggagacttat 60
trnT-r3 2397 tgcaagacgacttttgttc
trnT-RT 2306 ccgggttctttttgctttct 60
trnV-f 2298 tttacttgacaaaggtgagttgtt 57
trnV-f2 2402 acccaagtggttttgtcaag
trnV-r2 2299 ttgagcggatcctgacctac 60
trnV-r3 2403 aacagattagggctatacggattt
trnV-RT 2300 ttaattaggcatataacttaaactga 53
trnW-f 2301 gcaactcccacttccttcat 59
trnW-f2 2398 aaagaggcgcctttagttca
trnW-r2 2302 cttcaattttggggcgtatc 59
trnW-r3 2399 gcttaagcaatccctagcagta
trnW-RT 2303 cagatgtggaagatcgcttct 59
ycf10-f 2142 caacccaattttccgtcttt 59
ycf10-r2 2143 aaaaaggagcggaaataacaaa 60
ycf10-RT 2144 ggggaggtacaaatccaact 58
ycf12-f 2053 tttgtcaaaatagatagataagataga 53
ycf12-f2 2409 aaggagaagtaatgaatctagaaa
ycf12-r2 2055 ttgaatgaatccctgtaaaatacaaa 60
ycf12-r3 2410 aaattaattgcggaacaatctca
ycf12-RT 2054 cccctttcccatttcttatg 57
ycf1-f1 2252 caagcaataagtacgtgagactacaa 59
ycf1-f2 2255 tttgtcaaatgtagaacggagaat 59
ycf1-f3 2258 ggcagcttaaacctggatct 58
ycf1-r1 2253 tcgagccagatccatactca 59
ycf1-r2 2256 tccgcaattactgctacttctt 58
ycf1-r3 2259 aacttagcaactgagtgtatgtca 56
ycf1-RT1 2254 cgtctcctcccggtatatca 60
ycf1-RT2 2257 caccgtcggtttcaacatag 59
ycf1-RT3 2260 tcgtggataattgacttccaact 60
ycf2-f1 2213 gaaactggcagatcctctcttatta 58
ycf2-f2 2219 cgacatagattttgaaaaattgaaca 60
ycf2-f3 2222 tgggaaatagatagataagtagtctca 56
ycf2-r1 2214 ttgtttcatgacatcgaacttt 58
ycf2-r2 2220 tggtagtttcaccactggaaag 60
ycf2-r3 2223 aaccatcggataaacttgagaaa 59
ycf2-RT1 2215 aaacggagtggggagtatct 60
ycf2-RT2 2221 tgaaatttccacgtacattattga 58
ycf2-RT3 2224 tgaaaagaagtatctcttcgtcaat 57
ycf2-seq1 2216 acagtcgaatgttgcctatg 59
ycf2-seq2 2217 ttccattaaaagattggaaaac 55
ycf2-seq3 2218 catttattggtcgtgacgagtt 59
ycf3-f 2172 tgacggattagtaataggtgaag 55
ycf3-r2 2111 actttgacttccctatttagg 60
ycf3-RT 2171 ggtcgacgtctgagaaacaa 59
ycf4-f 2140 gaaataaatccaacgataaaatcaa 60
ycf4-f2 2413 atgatgaattcccgccctac
ycf4-r2 2141 tgaatttcaaaatccctcgattg 62
ycf4-RT 2139 tcgcccttttgcactatttc 58