DATA & PROTOCOLS » ADIANTUM cDNA SEQUENCES
Adiantum cDNA Sequences

Below should be the entire Fasta file that you can copy and paste.

>rps12
tCTTCTGCGTTTTCAAGCATGCCGACAAACCAACAACTTATTAGGAAGGCGAGGCAACGGCTGGAGAGTGGGACGAAATCCCCCGCTCTTCGTGGGTGCCCCCAACGGCGGGGAGTGTGTACTAGGGtGTAtACAACTACACCGAAAAAACCCAACTCTGCCCTACGTAAAGTCGCCAGGGTTCGATTAACCTCCAAATTTGAGGTAACGGCTTACATACCAGGTATTGGCCACAATTTGCAGGAACATTCGGTGGTCCTCGTAAGAGGCGGAAGGGTCAAAGACCTACCCGGCGTTAGGTATCACATCGTTAGAGGAGCCTTAGATGCTGTAGGAGTGAAAGATCGTAAAAAAGGGCGTTCCAGTGCGTTGCAGAGCATTGTCGCAACTCGTATCATCGCAACGATTCCGTATCAATTGTTCTGATATGT

>ndhB [prot=NADH dehydrogenase subunit 2]
AAAAAAAATCCAACGTCAAATATTACTTCGATTTTTATCATGAATGATATTAACTTATTTTTAGCAAAATTAACTTATACCTCCGCCAAATTGACAATTTTACCAGAAATTATCTTGATTCTAGGCTTAGTTGCAGTAGTTGTAATTGACTTATTGAGTAAAGGAAAAAACACATTTTTGCTTTACAAAATCTCCATGGTAACCCTTTTAGCTAGTGCAGTTATCTTGTTATGGCAGTGGGGATTTTTTACTGCTTATGAACGTTCTCACGCCAGAGATTTTGGGAATATTTTCAGATTTTTTTTACTCATTTGCTCGTTATTATCTATTTCTTCGTCGGTTGATTATATACTTTGTTCAAAAATGTCTTTAGCTGAATTTTTATTGTTTAAATTAGCTGCAGGTTTGGGGGGTATGGTTCTCAGTTGTGCAAATGATTTGGTAACTATTTACGTGTCCCTGGAATTCTTAGCCTTATCTTCCTGTTTTTTATCTGGATATACTAAACGGGACATGAGATCGAATGAAGCAACTATGAAATTCCTGTTGATGAGTGGAGCGAGTTCCTCCCTCCTATTATATGGTTTCTCTTTGTTATATGGACTTTCCGGCGGACAGCTTCAGCTTGACAAAATAGTTGACGGAATTATATTCAATCGATATGGTTCTATAATTTATCTATCTGCTGCGTTTATTACAGCCGGAACAGCATTCAAATTGTCTCTCTTTCCATTTCACCAGTGGACACCTGATGTATATGAAGGATCCCCTACACCAGTCGTTGCTTTTTTCTCCGTTACCTCCAAAGTAGCAGCTCTAGCTTTATTTACAAGACTCTTCGGTCTAATTTTCCCATACTTCTCTAATGAGTGGCATGTCGCGGTGGGATTATTAGCTACCTTTAGCATGATATTGGGAAATTTAATTGCCGTTACTCAGAGAAGCGTAAAACGTATGCTAGCTTATTCTTCTATAAGCCAAATTGGATATATCATGATTGGGGTACTTTCTGCAGACTCAGGGAACGGTTACGCAAGTATGATAACTTATACGTTTATCTATATATTCATGAATTTGGGAACTTTTGCTTGTATCACCCTATTTGGTTTACGAACCGGAACTGATAATATCAGGGATTATGCGGGATTATACATGAAGGATCCTGTTCTAACATTTTCTTTGGTTTTATGTTTACTATCCCTAGGGGGTATGCCTCCACTATCCGGTTTTTTTGGTAAACTCTATCTCTTTTGGCATGGATGGAAAGCTGGTTTGTACTCATTAGTTCTGGTGGCGCTCGTCACAAGTGTCATTTCCATCTATTACTATCTAAAAATAATTAAATTAATGTTCACCGGGAAGAGTGGGAGGAGCGATACACCCCTAAATTCTAGACAAAATTCATTAGTTTCTCTATCAATTTCGATTTCGAAAAATTCTCTTGAAATAGCTATGATCATTTGTGCGCTAGCATCAACCCTATCGGGTATATTCATAGATCCTATTATCGAGATCACACGGAATACCTTCTTTTAGACCCACTT

>matK [prot=maturase K]
gcgatgaaagtcaattacggatctcctgctaaatctggtcctttacataagaacggggagttttatattaacaagaattgttttttacacccacttctttttttgtctgaggagaatttttatttgacagatggcaaacgccgatcacatggtgcagacgccaacttggtttttggggcctggagtacggtggcagtcaaacgtttaattggtagcgtacgtgaccctaatctaaattttttgaaaatttacgattcagtgtctgttcgaaacttaaccgacggattagacgtggatttgtatcttcacccgcttttgaaaatgacatatctcatattaggcatagccctttttcctaaaatcagagctgaaacaagtagtaagtcaaagatgttgcagtctattcattcgatgtttttatttctggaagatagattttcaaaatctaatcatattttagaagcggatttgccacataatcttcatctagaaactttaattcgattgttccgacgacaaattaaagatgtttcatttctgcatctgctaagaatagtttttcgtaaaagaaaaatattttgcggaaaaactttttattcccctgggggggggcaagacggaagtgttgacatcccagttcgaaatttctacatcttcgagatcgattcacttctactgatcccctggaaacaggtatataaattccgagtcaattatttatcccctatagatagttgtaatatcattcggaaagagatatatgcttctgcatataaattcaaatggaacaaagcgagtattgattactcctttagccgaagtttgtggattcattacggaagatggagaaacaaatttcttatagcctccgagggaactcactattttgtgaaaaaaatgctttactatctttggatacttctaaaatatcattttcactatcggatcaaatctaatgaaccctggataagaaaattattacccactagctgcgtctcattcctgggttatacactactagcgcaactggtatcaaaaaatgttcgtattgaaaccgtgacagatttgtatatcagtattttgggtggaaaaaagttttatcctaaaattccaaattcaataataattactaccttggcaaaacaaagattttgtgacttcactggacgtccgattggtaaatcggcctgggttacttctacagatgataaaataattgatggatatgtccaactttggcaagttttttccttgtattatggtgcctcgatgaatcagtatagattgcgcagattgatatttctattgcagatgtcatgtgatagtacgttagctggtaaacatagaagtacaatacgtctcttgagatgtaaatctaatgtagaggcgctcaatcaaattctggcatctagaaagtttgaattgtctagtagtcggagggtttggcgttcatcttcgatacggtctgtcttagtacaattcaccgtattagatatcgggctctgagagatttaggaattgctact

>rps16 [prot=ribosomal protein S16]
ttagatcttatggtgaaattacgcccgaagcaatgtggtaggaagcaacggacttaccgaatagttgcaattgaatcccaatcccggcaagaagggaaagtaattaaagaggttgagttttataaccctcggagggaggaaacccagctagatattttggctatcactaccttgtgcggaagcggcgtcaaattaacagaaactgtttgcaatattttcagacgggcaacttttaaaattacttgaacgcagtaaagacaaatttccgaaataagagttaaaattt

>chlB [prot=photochlorophyllide reductase subunit ChlB]
tattatgatgataagccacatgtagcaatagatttttttgggatacgaagcaacgaaatagtgaaagtaaactatgaaattagcttattggatgtacgcgggacccgctcacatcggtaccctacgggtagccagttccttcagaaacgtacatgctataatgcatgcccctttaggagatgattactttaacgtaatgcgttccatgctggaaagggaaagagattttaccccagtaactgctagtgtagtggatcgccacgtgttagcacgtggatcccgggataaggttgtaagtaatataagccgaaaaggtgaggaacaacgccctgacttaattgtattgacacctacgtgtacctctagtatcctacaagaagatttacaaaattttgtggatagagcttccctgtattctgagtccgacgtaattctcgccgatgtcaatcactaccgagttaacgagcttcaagcttcggataaaactttggaacaaatagttcgatattatttagatagggcccgcaaggaaggtatttttaaccggtccctgacagatgttccttcagccaatattataggaattctcaccctaggttttcacaatcaacatgactgtcgcgagttgaaacgtctacttggagaattgggggtttcaattaatcaaataatcccagaaggagagtttcttaataatctcaaggatttgccaagagcttggtttaatatagtcccttaccgggagataggtttgatggcagcaagtttcttggagaaagaatatggaatgccttatatatcaacaactccgataggtatttcaaatacagccgacttcgtaatgcaggtggaaaaacttatgaatttctgggctactgtattactgggaaagaaatttcattacgatcaatatgttgaaaatcaaactaaatttgtttctcaagcagcttggttttccaaatctatcgattgccaaaatttagctggaaaagaagcagtggttttcggcgatgcaactcacgccgcctcgattaccaagatactctccggagagatgggaattcgtgtaagttgttcaggcacgtattgcaagcatgacgcgggatggtttaatgagcaggttcagggtttgtgtgatgaagtaataattacagaagatcatactgaagttggggatacgatagctcgtattgagccctctgctatatttggaactcaaatggagcgtcatatcggcaaacgtattgacatcccgtgtggggttatttcttcaccagttcatattcagaattttcctttaggatatcgaccctttatgggttacgagggaacgaatcaaatatcagatctaatatacaattcattcaatctgggtatggaagatcacttattagacgtgtttggaggacacgacaccaaggggataagcaccaagtccctatctacaggtggaaaatctattgattggacccccgaagctgagtcggaactaaagagaatccctggttttgtgaggggaaaagtaaaaaaaaataccgaggtttttgcaagacaaaacaatattttgaaaattacagttgatgtaatgtatgcggctaaagaaagaagatcgattgagtccttagcttagttcgaggaac

>psbK [prot=photosystem II protein K]
gacatgacagtctcgtacagtatttatctagaaaattctcttcactttggcgatgcccttttggccaagttacccgaagcttatgccattttcgatccaattgtagacgtaatgccggtaatcccggtgttctttctcctcctagcttttgtttggcaagccgcagttagttttcgataa

>psbI [prot=photosystem II protein I]
gttgtagacatggagttacatcatgcttaccctcaaactatttgtctatgcagtggtcatattttttgtctcgctttttgtatttggatttttatcaaatgatcccggacgaaaccccggtcgtaaagattgaaggagaagtagtgttt

>ycf12 [prot=hypothetical protein]
gaaaaaatatctatctattaaattaaggagaagtaatgaatctagaaataatcacacaactcgtcgtactcacacttgtagctgcatcgggaccgttagtaattgcactattggctatccgtaaaggtaatttatgagattgttccgcaattaat

>atpA [prot=ATP synthase CF1 alpha chain]
aaatggtaataaacattcaacctgacgagattggcagcatcattcgcaagcaaattaaagggtatgttccggaaatgaaagttgttaacatcggtactgtgcttcaagtgggagacggaatcgcccgtattcacggacttgatgaagtaatggctggcgaattggtggaatttgaagacggtacagttggcattgctttgaatctggaatctgataatgttggggctgtgctgatgggtgatggtctaactatacgagaagggggttcagtacgggcaacgggtaagattgctcaaataccagtcagtgactcgtttttaggccgcgttgtaaatgcattggcgcaacctatcgatggaaaaggacaaatcccagcttctgagttcagattgatagaatcttccgctccggggattatttcaagacgctccgtgtacgaacccctacaaacaggtctgattgctattgattctatgattcccatcggtcgtggccagcgagagttaattattggggatagacagactggcaaaacggcagtagctacagatacgattctaaatcagaaaggtcaaaatgtcatatgtgtttatgtagctattggccaaaaggcttcatctgtggctcaagtagttgacacctttcgggaacgtggcgccctggaatacaccatcgtagtctcggaaactgcaaactctccagccactttgcaatacctcgcgccttacacaggggcagctctagccgaatacttcatgtatcgcaaacagcatactttgattatctacgacgatctctctaaacaagctcaagcttatcgacagatgtctttattattgaaacgcccgcccgggcgagaagcgtatccgggagatgttttttacttacattcccgcctcttggagagggccgctaaattgagtacccaattaggggagggcagtatgacagctttacccatcgttgagacacaggcaggagatgtctcggcttacattcctaccaatgttatttctattaccgatggacaaatatttctatcagcagatttatttaacgccgggattcgaccggcaattaatgtgggtatctctgtatctagggtaggctctgcagctcaaattaaagcaatgaaacaagtagccggtaaattgaaattggaattggcacaatttgcagaattggaggctttcgcgcaatttgcttccgatctcgataaaactactcaaaatcaattagctagaggacaacgcttgcgcgagcttctcaaacaatctcagtcagccccattagcggtggaagaacaagtagctaccatttacaccggagttaacggatatttagatgttttagatgttgaacaagtaaaacggttcctggttcagctacgggaatatgtagcaacgagtaaacctagttttggggaaattattcgttctacaaaggtgtttacggaacaagcggaagcccttttgaaagaagcaattaaggaatcaacggaactttttttactgcaagagagatgagtatgac

>atpF [prot=ATP synthase CF0 B chain]
gaaattgcccaaaacgtaaaaccttcgaggagggaaaagaatatgagaagtctaagtgagatcatcgctccctcgagttattggaccctcgctggaactattgggctaaatactaatatatttgagataaacctaattaacttaatcctggtactaggtatattattttattacggaaagggggtgttgatcaatttattagaaaatcgtgaaaggacaattttgaacacgattcaagatgcggaagagcgccacaaagaagcgactgaaaaacttcagagagctcgtcttcgattgcaacaagcggaaatgaaagcggacgagattcgcattattggacttacgaaaatggatagggaacggcgagatctcgttgatgcagctgacaatgatttaagggaacttgaagagagtaaaaattatgcaattcgttttgagaagcaacgagcaattgagcaggttcgacagcaagtttctcgactagcctccgaaagggctttcgaaagcttgaacggtcgtctaactaatgaatttcagctacgaatgattgattaccacatcggcttgctcagagccatggctaacaaatccacgtaatcacagctt

>atpH [prot=ATP synthase CF0 C chain]
taaataggaggagactaatatgaatccattgatttctgccgcttccgtcatcgccgctgggttagctgtaggccttgcttcaatcggacccggtgttggtcaaggcactgccgcgggtcaggcggtcgagggtatagcaagacagccagaagcagaaggtaaaatacgaggcactttattgttaagtttggctttcatggaagctttgacaatttatggattagttgtagctctagccctgttatttgcaaatccgtttgtctaaac

>atpI [prot=ATP synthase CF0 A chain]
ggggggggggtattatgcaaattgaacaattgcaaattaatgaaattgataatctgcatcaagtatcaagtgtagaagtaggtcaacatctctattggcaaataggaaactttcaagttcatgcacaggttcttataacttcttgggttgtcgtcgccatattggtagctttacccgctacaactaccggcaatttgcaatcgataccaactggtacacaaaattttatcgagtatgttcttgaatttattcgagatttaaccaggacccagatgggggaagagggatatcgaccctgggtcccatttattggaacaatgtttctatttatttttgcttctaactggtcaggtgctttgctaccctggcgagtcattcagttacctcatggggagttggctgcacctacgaacgatattaacaccaccgttgcattagccttgcttacatcagtagcatatttttacgcgggtttgtacaagagagggtttagctattttggcaaatacatacagccaactccgatactcctacctatcaatattttggaagacttcaccaaacccctatcgcttagtttccgattgtttggaaacattttggctgacgagttggtagtagctgttctcgtctccctagtacccctaattgtccctgtacctatgatgcttttgggattgtttacaagtggcatccaagctttaatctttgccactttagctgcagcttatatcggggaatctatggaaggtcatcattagtgggatgaggaaacgtaactctaattt

>rps2 [prot=ribosomal protein S2]
cataaaagaggggaagatgcaacagaaaaattggactatcgacttggaaggaatgatggcagcaggaattcactttggacatcaaacccagagatggaatccaaagatgtctccttatatatttacagaacgtaagggtgttcatattctcgacttaactcagaccgctcgtctcctatctgaagcttgtgacttggtatttgatgcagcagtagagggaaaggagttcttgatggtgggtacgaagaatcaagtaactgatttaatagtatcagctgcattgaaatctcaatgccattatgtaaacgagaaatggttagctggtacgttaacgaattgggtcactacagagacacgtctccgcaggtttcaacacttacaaactgggggcgatttgggagaattcgaccgacttccgaaacgggaggccgcgattttgaagggacaattggttagattaaaaaagtgtctaggtggaattcaatatatgtcagatttacccgatattgcgataattaccgatcaacacgaacaatctattgccctcaaagaatgcagtattctgggtattcccacaatctgtatcgttgatacagattgtgacccagatcttgtagatgttccaattcctggtaatgatgatgctagatcctcgatccgatggatattggataaacttgcattagctattagcgagggtcgttcaaacataaaggtaacttaatgggcc

>rpoC2 [prot=RNA polymerase beta'' chain]
acaacatatatatatatgaagttgaggtcttcataatgatggatcgaaatgaattacctttctgcaacaagacgatcgatagggctgcgatgaagagactcatcggcaagttagttgtttgtttcggaattgcgtctacaacaaatatcttagatcaagtgaaagttttgggttttcagcaagctacagaagcatctatctcattgggtattgacgacctttcagcagtaccaaccagaggttggcttgtacgagacgcggagaaacaaggttacgtctcggaggggcattaccgctgcggaagtctgcatgccatagaaaagttgcgtcaatcaattgaagcctggtatgccacaagtgaatgtttgaaacgagaaatgagtccaagtttcaagatgattgatcctttgaatcccgttcacatgatgtctgtttcaggagcccgagggaccatctcccaggtccaccaattgcttggcatgaggggattaatggcagatcctcgaggtcaggtaattgacctacctatccgaagaaatctgcgcgaaggtttatccctgacagaatatattatttcttgctacggtgctcgcaaaggggttgtggataccgccgtgcgaacttcagatgccggatacctaacacgtagacttgtcgaagttgttcaacatattgctgtacgaagaagggattgtgaaactcctagaagtctcgcttttttgacttcaaatactggcgaacgaagacgaggatttcttggcacgatgccgcatcagggattggttggacgtgtgttggcggatcatgtttactgggatgttagatgtattgccacccgtaaccaagatattagcgacggattggctagtaacttgatggcgtcctcgcagccaatacatgtgagatctcctttgacatgcaaaagcattttctggatttgtcagttctgctacggttggagccttgcccattgcaatttagtagaattgggtgaagccgttggtatcattgcgggtcaatcaattggagaaccgggaactcaattgacattgaggacttttcatacaggtggggtatttacaggggatattgcggagtacgtacgaattccattcaatggacttattaaatttgacgaaagattacttcatccgacccgtacgaggcacgggcatcctgcttggatgtgccgaaacgatttacccctctttattggcaattccgtcggtacacaaaattctcttattccagcccagagtctgcttatgattcgaactggtcaatatgttgagtcgcaacaagttatcgcggaagtacgagccaaggagtttcctcccaaagaatgtattagaaaacctatttatccaaactcgaggggagaaattcactggagtaaatttgtttggcatgtccgtgattccatctgcaatatcgctcgtctcgtacgagaggcgagccatatatggattctttcgggatctccatccaaatttgatgggaactctttttttcataaagatcaagatagagttaggataaaaccccaccctatcaaaaggatacgcagtcactcggagggaatttttgaagcacaagccagtgctagtaactgcgtagatcgtcgaaaagggattcaagaatttggaaccgattcaaaatatttttcaaattggtcaaaacgtccgagatccaattacatcctttcaaatgtctggttggagcgggccgagctagaaaactcggtttctttgctgatggaacgatgccaaaaaaatatcaaaaaattagattttgtaagtatcaatgttcaattaaacaatggttcggatcaggatcacatttttgccacctatgaaaacttcgagtatcaaaccatcgtttcagggatcataaagtatggcactgtagaaattaaaccggtcaatccgaagagactccagttagatggtgggacagggaataaaagttctcgtccttggtgcagggtagttagaaaaggaaatttcttcctgattccagaagaggtttatcttacgcacgaaccctcgtcgtctattttggtgacaaataatgctattgttaaaaaaggtgcgcaaatcactaacaatattattaccaaatcaggtggattgattcggatgagaaagagatcaagagatgctactacaataagaattctccctggatatatttataatccagagaagcaaattaatatatccaagcggggtaatacattactagcgccgggtaataggatttcggatgacattgaagtcaaaaattggatttacctacaaccatttacatttcgcagaaaaggaaaaacctttgtcctgatgacaccagttagcgagtataacttatccagcgattctctggcacaagtagcatctcgatttgacaaaccaaaaacacagagacgcgcaaaagccaagaccctttcgttcatttgttgcaaaaatggggaaaaaattgaagtaattaacgatgtgcctactcaattagttcggctttgtttgataattgaatggcagaaatatttgcacgaaacccttcctagaaaaagaaactatttctctcttatcagtgtgaaaataagttatttgttcaaaacttttcttcaagtaaatccgatggtatctccccctacacaaagaggagtcagggttgatgaaatctttcgaacatcaacgcctcttggcaaaccatctcctcctcaacttgatctggctaacagttgttgtaaatcagctgtcaactgtcagggtatcattcatttgactttggaaccagccacatcattcctgatcttgtcgccatttaatttgtcccgtaataattcagttactgatacgagggatggtggttgcggaggagaaattgggaaatacttctacgggtcagaagatggtttcttctgcatcggcgagaataaaaaaaagatctcactgagttctaaatgtatttcagaaaattatgcaaatccaaatgttgaagagggatggattaaagctagaagagcaagttccaatctcggccagaggaaagctgaggaggtaggtctagtggggactttgtcccctatttcttgttcatcgattccccatcatctatcactcggcggcaaaaacctttctaccagaaaaggtttcgttgattattcgatagataagtcggaacatcaagatttctatctgattgatgaaagtaaattactactgaaatgccccataaatttttatgttaaaaaaggtttcttggacaaaccttcttatttaccgacaagagtgtttagtcgagaaatcatgttaattagtctaggactactgatcagtgaaagtcgatatctacatcgagatcggacatgtttccaatctggccaggtcatggccattcaccaagattattcattagtgagaacgggtaaaacctttttggcaacccggggagcaaatccccataagagttccggggatatccttgaggaaggagatacgttaataacattgccgtatgacagattgaaatctggagacattactcaaggtctcccaaaggttgagcaactcctggagtcccgttccattgcttctatttcagcaggaattggagatctttttgagaaatggtgtcaaaatattactaaattaattgggaatccctggagtcacttgctaggtgctggaagaagtatggagcattgccaattgattctaattgatcaaattcgaaaagtttatgagtctcaaggagtacggatatgcgacaagcatctagaaattattgtccgccaattgacatctagggtcgtagcgtctgaagatggggtaactaatgtattccttcctggggagcttgttgagttatcacaggcggaacgtataaatcgtgttttaaagaaatcaattttttacgagcctattgtattgggtatgacgagggcttctcttagtactactagttttttggcggaagcaagttttcaagaaaccactcgagtattggctaaagctgcccttcgcggccgaattgattggctgaaggggttgaaagaaaatgttgttattggcgactccgttcccgtcggaacaggtagtccagaaatctattgtcaattaaatataaataaagagaaagaatctcgtttggcaagtgggggtagtaagaagttgacaaaatgggagactggaagtagtctaagtggttaccataaaaaacgggatttcaatcccagttttttcattcgtaaagaattgaatagatctttcactcgtcttcatcttgatatgtggtaaaaagtggcagacaatttcttcgcgc

>rpoC1 [prot=RNA polymerase beta' chain]
ttgatatttccttgaaatttctcttgtgaaaattaattgagagtttattatgattcatcgaactaattatcaacaacttcggattggactagcttctcccgaacagattcgcagttgggccgaaagggagttacctaatggagatgtcattggacaagtcgatcaaccttacacattgcactataagactcacaaaccagagagagatgggttattttgcgaaagaatatttgggcctacaaaaagtggagtctgtgcttgcggaaactgccgatctgtcaatgacgaaggagagtcttccagattttgcaagcattgcggagtcgagtttactgactctcgagttcgtagatatcggatgggatacatcaaactcgcgtgtccagtaactcacgtatggtttcttaaacgaatccctagttatattgcaaacctactagccaaacctcttaaagaattggaaagcctagtctattgcgatacctatcccaatctttttctagctaggcccgtggctgaaaggcccgctctattaagactgcgggggctgttcaattatgaggatcgagcctggagaaacatacttcccacttttttttctacccaaaattacgagatgcttcgaaaaaatgaaattgttactgggggagatgctatcagagaaggattagctagcttagatttgcaaagttttcttaattgcgcgtatttagagtggcaggcgtcagtaaaacagaagccagttggaatcgaatgggaagatcgaacaattcgaagaagaaaagatcttctgatcaggaggattaaactagccaaggattttttacggacgaatatgaaacccgaatggatggttttatattttataccggttctcccgcctgaattaagaccaatagtggaattgcatgaaggtgaattgattacctctgatcttaacgaactttataggaagattatttaccgaaataatactctcagagaattcctatcgggtagtgaatttacaccggaaggattaattgtttgccaaaaacgacttgttcaagaagctgtagatgctctcatcggtagtggtatacgtgggcaaccaatgagggatattcataatagaccctacaagtcattttcagaggttattgagggcaaggagggtcgatttagagaaaatctactcggcaagcgggtcgattactcaggtcgctccgtaattgttgtcggcccatctctttcattacaccaatgtggattacctcgagaaatggcaattgagcttttccaagcttttgtaattcgcaatttgattggacgacaccttgcctgtaatttacgagctgctaagtgcatgatacggaaggggaatcccataatatgggaagttcttcgggaagttatgcgaggccatcctgtactgctgaatcgggcacctactttgcacagattaggcatacaggcgtttcagcccctcttgatagagggacgcgccattcgtctgcatccattggtttgtggggggtttaacgcagattttgacggggatcagatggccgttcatgtccctttatctgtcgaagctcaaatcgaggctcgtcttctgatgttttcgcatctcaatttattatctcccgctacgggcgatcccgtatctgtaccgagtcaggacatgcttcttggtctttatgcgctaacaattgaaagtaggcaaggaatctatagaaatagacatcttggttttatagacagggttaacgtatattccaccaaactacttcatttcagcagttactgtgacttacttcgggccaaggaatcgagacaagtggattcccacagtctattgtggcttcgatggaaaatcgatctgcaaattattagttcgaaaattcgtgaattatcttccgaatctcattatgaatcgtcaggaacttcttttcacttctacgaaaattgccgaattagaaaatgtagggatggatctatctctagtatgtatgtacttacaacagccggtcgcattttattcaatcaacaattgaaggaagcaatgcaaggtgtatcaaagaattctttttcatacaccacctcatctacgctgagtacatcaacaatcgataggtgtaatactaatagtaataatgaggaatgataaagcttttta

>rpoB [prot=RNA polymerase beta chain]
gtggaggtatgcccgtactgccagaacttgcacaaattcaatttaaaggttttagtcgtttcgttcatcaaaaattgcttaaggaacttgaaaatttcccaaaaattgaagatacagataaggaagtagaattccgatttattggaaatcagtaccaattgacagaaccttctctcgaagagagagatgccgcgtatcaatgtattacgtattccgctgacctatatgtaccagctcaattgatttgtaaggaagaccaaatagtgcaagaggaagatgtacgactcggatctattccttggatgaattccggaggaacatttattattaatgggatcgctagagttttagtcagtcaaatattgaggagtcctggtatttactacaatcgggagtcggatcagagagggattctcgcgtataccagcaccgtaatttcagatcagggagggagatttaagctagagatagacgggaggaatagaatatgggttcgtataagcaagaaaaaaaaaatatctatttttattctactagtagctatggggttatgcaaaagagatattctacaaaactcccgttacccaaggattttttcaaatatgttcaaaaggcaaaaagaaagtattgaatctccagaggatgccatagtagagctgtacaaacacctatactctgctacagacgcagatgtattcttttcggaatccatatttagggaattacagaagaggtttttccaacatagatgcgaattaggacgaattggtagacgaaacctaaacatcaagctaactcttgatgtacccgaaacggagtcttttttgctaccccaagacatattagcagctgcagatcacttagtagaaataagttacggagagggcaaactcgacgatatagatcatttgaaaaatcgacgtgttcgatccgttgcagatttgcttcaggaacaattgaaattagctctaaaccgtttggagaatttgattcgacaaaatttatctagagccgttaggcgcaaacgcgcaatcactccccgggggttggtgacacccgtgccagtaatagcagctttcaaggagttttttggttcacaccccctttcgcaatttttggaccaaacaaatccattatctgaaatggttcataaacgaagattaagctctgtaggtcccggcgggttaacacgtcgaaccgctagttttcaagctagagatattcatttcagtcattatggtcgcatctgcccaatcgaaacatcggaaggtatgaatgctggcctgatttcctcattagctattcaggcaggagttaacacttcgggatctttggggagcccttacctcgaaatgtcagattcgtctggggaggagcagttagtcaatttatcacccgcagaagatgattattaccgagtagcaagtgagaatttactattatccgaatggagaggttcggagaaggaaattataccagtgcgatatcaacaagagtttctcagcgttctctgggaacaagttgattttcgaagtattcatcctctccatcatttttccatcggagcttctctcattccattcattgaacataatgatgcaaaccgtgctttgatgggttctaccatgcaacgtcaagctgttccattaattaagcccgaaagatgcattgtaggaactgggttggaaagtcaagtagctttggattcgggaagtgtagctatatccgaacaggatggtaaagtttgctatattgatggtaatagaattgagctatctcttatccacgaagcgaaaaagaacaaattggctcaacctactacaattgaggaattaaaaatatttgagcgttccaataataacacctgcatgcaccaaaaacccgcggtttcgctgggagaactcctgagaggcggagaaatcgtagcggatggagcagcgactgtcaggggggaactagctctgggtaaaaatatattagtagcctacatgccgtgggaaggatacaacttcgaagatgcggtcttgattagtgaacgccttatctatgaagatattttcacatctcttcacatcgaaaaacatgaggttgaaatttgtgcaacaaatcaaggacctgagcgggttaccaagcaaatatctcaattggatggttatttacttcgacacctcgacgacgatgggctcgtagaattaggatcttgggtggaggccggagacgttttggtaggtaaactgacgcctcaggagggggcaagctcatcacgtgttccagaaggaagattattacaagctatttttggtatacaactggttaatgcaagagaaagttgtctaagagtacctattggtgggagaggtcgagtcattgatgtgaggtgggtataccccgaagatgatgctacaaatgatttggaagtaattcatatatatatattgcaaagacgtaagatacaagtgggtgacaagatagccggtaggcatggaaataaaggtattgtatcaaagatagtacccaggcaagatatgccctatttgcaaaatggtacgccggttgatatgatactaagtcccttgggagtaccttcacgaatgaatgtgggacagattttcgaatgcttgcttgggttagccggggagtttttagaaactcattaccgtgtagtaccctttgatgaaagatatgaacgggaagcttccagaaaactagtatttgccgaacttcacgaagcgggtgcgcggaccaataatccgtggctattcgaacccagccaccctggaaagagtcgattgatcgatggacgaacgggtgatccctttggacaatctattacaactgggaaagcttatataatgaaacttattcatcaggttgatgataagattcacgcacgatctagtggtccctacgcgctcgttacacagcaacctctcaaggggaaatcgagacgggggggacaacgaattggagaaatggaagtctgggctttggaggggtttggggtgtcctacaccttgcaggaaatgcttacaactaaatcagatcatattcaggctcgctacaaagcacttagtgcaattatgaccggaaaaccagtttgcaaacctaaaaccgttccagagtctttccgattgctagttcgggagttacgatgtatgggcctaaatttggaacgcaatttcatatctgaagaagatttgggaagggaatttgaaaacatttgatatt

>psbM [prot=photosystem II protein M]
ttatttcccaattaatgatttgaactactaatatggaagtaaacattcttgcgtttgtagccactgcacttttcattctaattccgacagcttttctactcattctttacattcagacggccgcccaaaataatgggtagttatcaattactc

>petN and trnC [prot=cytochrome b6/f complex subunit VIII]
gtcctcgatggtcttttcaagtcggcattagaatagaatctttgaaacggggcgatatagtcaagcggtaagacgtaggactgcaaatcctcaattccccagttcgaatctgggtatcgcctggaagaagaaatggaaaataacaatttggaagattaaattcatctaattttactcacccatctaggtagggttttccggggattgcttggtgcgccgaaatcggatacaggttgagttgctctatagcttgttatagcctaacacattccacgtatctcgacaaatcacgcatcgacaatcccgaataagtatactactacttagtcagtagcaagtaggaattgacaaatcctacaaaattataaaaactacccagtaacattggaaaagacgacttggatttatacatactcgttgtttctcgctactaggggggtatcctgcagaagaagatatctgattcttattacgtactttgacgcttccaaagatttaatatgcatctgagctcgaggctagttaGttatcggtaaaatttggggagtgaaaagataggaattataattatggattcagtactatagcttgggctgccttgatggcaatttctacgttttccctctcgcttgtagttcggggaagaagtgggttgtgacttgtgtcgagtagctaa

>psbZ [prot=photosystem II protein Z]
ggaattatgactactgcttttcaatttgctttatttgcattaattgctacctcatttttactagttgttggtgtgcctgtggcgtttgcgtctcccggaggatggtctgacaacaaaaatattgttttttcaggggcctcattatggattggattagtttttttggtaggtatacctaattccttcatctcctaaaagtctgttttggt

>rps14 [prot=ribosomal protein S14]
ctaccaattatggcaaaaaaaagtcttattgaaaaggagaatagtaagaaaaaattggtgaaaaaatataatcttcttcgccaatttttgagacgagagattaagaatagtttgcggatccaggataaactaattatttccgaaaaattgcaatctctaccacgcaacagtgcacgcgttcgtctccgtaaccggtgctccctaaccggacgacccagatccaattatcgagattttggtttttccagacacgtactccgcgagatggcacacacctgtgtcttgcctggagtgttgaaatcgagttggtagaaaaactacttaccccccccccc

>psaB [prot=photosystem I P700 apoprotein A2]
ctggcgagaatcgttgcagtgggataatggctaggaggatttgagaaacattatggtatcaagatttccaaagttcagccagggtctatcccaggacccaactactcgtcgtatctggtttggcatagccactgcgcatgattttgaaagtcatgacgatactaccgaagaacgtctctatcaaaaaatatttgcatctcactttggtcagttagctattatttttctatggacctctgggaatttgttccacgtagcttggcagggcaactttgaaacatgggtacaggacccattacatgtcaggccgattgcccatgccatttgggatcctcattttggtcaaccggcggtcgaagcctatacccggggggggtccgcgggcccggtcaatattgcctattccggcgtatatcagtggtggtacactattggtttacgcaataacgaagatctctacaccggagccatttttctgctagctgttgctgctttgttcctactagctagctggttacacctccaacccaaatggaaaccaagcatctcctggttcaaaaatgctgaatctcgtcttaatcatcacctatcaggattatttggagtgagttccctagcttggacaggccacttgattcatgtagctattcccgaagcaaggggcgggcatgtcagatggaacgatttattgactactgccccgcatccccaggggttgggaccttttttttcgggtcaatggagcgtttactcgcaaaatcctgactctaacacccatttgttcaatagcaaccaaggagcaggaacagctattctaacttttctggggggattccatccacaaactcaaagtttgtggctaactgatatggctcatcaccacctagcaatagccgtcgtgtttataattgccggccatatgtacagaactaactttggtattggacacagcatgaaagaaattttggatgctcacattcccccgggaggtaagctgggacgtggacaccggggactttatgatacggtgaataattctctccacttccaattaggacttgctttagctgctttgggagtcatcacctcccttgttgcacaacatatgtattccttacccgcctatgcttttctagcgcaggattatacgacccaagcagcactatatactcaccaccaatacattgccgggtttatcatggcaggagcttttgcacatggagccatcttctttcttagagattatgatcccgagcagaatagagataatgtgttggcaagaatgttagagcacaaagaagcaattatatctcacctaagttgggctagtttatttctgggttttcatacgttaggtctttatgttcataacgatgtaatgctagccttcgggactccggaaaaacagattcttattgaacccgtatttgctcagtggattcaatctgctcatggtaaagtttcatacggttttgacgtgcttctatcttcagtagatagtccggcaagtaatgctggtcggggcttgtggttacctggctggttagacgctgttaacagtagcaataattcgttatttttaacgattggtcccggggattttctcgttcaccacgccattgctttaggtttacacaccactacactaattttggtgaaaggtgctttagatgcacgcgggtccaagttgatgccggataagaaagaatttggttatagttttccttgcgatggccccggccgagggggaacttgcgacatttctgcctgggatgctttctacttagctgtcttttggatgctgaacacaattggatgggttaccttctattggcactggaaacacatcactttatggcagggcaatgctgctcaattcaacgaatcttctacgtatctaatgggatggctaagagattatttatggctaaattcctcgcagcttattaatggctataacccctttggtatgaacagcttatctgtgtgggcatggatgtttttgtttgggcatctcgtgtgggctaccgggtttatgtttttgatttcgtggcgcggttactggcaagaactcatcgaaactttagcttgggctcatgaaagaacgcctcttgcaaatatgatacggtggaaagataaaccggttgccctttctatcgttcaagcgcgactggttggattagcgcacttctccgtgggttatatatttacctacgcagctttcttgatagcatctacatcaggtaaatttggctagtcttcatctttgttcaactacaaaattgct

>psaA [prot=photosystem I P700 apoprotein A1]
gaaattttatatctcctgttggtaggttgttgctatcccctgctcgaagagaggagagtcccaatgactattcgttcgccagaaccagaagtcaaaattatggtagagaaggatcctgtaaaaacttctttcgagaagtgggctcagcctggacatttcgcaagaaatttagctaagggtcccagtaccactacatggatttggaacctacacgccgatgcccatgattttgatagtcataccaatgacttggaggatatatcccgtaagatatttagtgcgcattttggccaactagctattattttcatttggttgagcgggatgtattttcatggagcccgtttttccaactatgagtcatggctgaatgatcccacacacgtaaaacccagtgcccaagttgtttggccaatagtgggtcaagaaatacttaatggagatgtgggcggggggtttcagggcgtgcaaataacgtccggattcttccaactatggcgagcttccggaataactagcgagttacagctctattgcacagccgtgggtgctttagtttttgctggattaatgttttttgctggttggtttcactatcacaaggctgctccaaaattagcttggtttcaaaatgtcgaatccatgttgaatcatcacttggccggtctattgggattgggatcgctaggatgggcgggacatcaaatacacgtatcgctccctatcaatcagctcctagacgcaggtgttgaccccgaagaaataccccttcctcacgaactcatccttaatcgtgatcttctagctcagacgtatccaagttttgcaaaaggattaattccgtttttcactttgaactggtcggaatactcggattttctaacttttcgcggcggattgaacccgataacagggggtctgtggttgactgataccgcacatcaccatttggccattgcggttctctttttggtagctggtcatatgtacaggacaaattggggtatcgggcatagtacgaaggaaatactagaagctcataaaggacctttcacgggtgagggacacaagggtatttacgagattttgacaagttcatggcacgctcaattagctattaatcttgccactttgggatccttaacaattattgtctctcaccacatgtatgctatgccgccttatccctacttagctaccgactacgcaacacaactttctttgtttacacatcacatgtggatagggggtttcttaatagtgggagcagctgcacatgcagctattttcgtggtaagggattatgatccaactactcaatacaacaacctgttggatcgtgtcattcgtcatcgtgatacaataatttcacatcttaactgggtctgcatcttccttggttttcatagcttcggtttgtatattcacaacgatactatgagtgccttggggcgtcctcaagatatgttttcggataccgctattcaactgcaaccaatctttgcccagtggatccagaatactcacgccttggctcctggatcgactgcacctaacgcaacagcaggcaccagcttggcctggggtgggagcgacttagtagcagtggccggcaaggtggccttagctccaattccattaggcaccgcagattttttggtgcaccacatccacgcattcacaattcatgttactgtactaatattattgaaaggcgtcttatttgcacgcagctctcgactaatacccgacaaagcaaatcttggttttcgctttccttgcgacggccccggaagggggggcacctgccaggtatctgcttgggatcacgtattcttggggctattttggatgtacaactctatttcagtggttatatttcatttcagctggaagatgcaatcggatgtatggggaagtgtaagtgaacagggagcagtgagccacatcactggaggaaactttgcacaaagttcaacgacaatcaatggatggctgcgagattttttgtgggcacaggcttctcaagtcattcagtcatatggttcttcattatctgcatatgggcttctattcttaggggctcattttgtctgggcctttagcttaatgtttctattcagtggtcgcggctattggcaagaacttattgaatctatagtttgggctcataacaaattgaaagttgctcctgttacccaacccagagctctgagtattatacagggacgtgcagtgggagtaactcattaccttctgggtggaatcgccacaacttgggcattcttcctggcgagaatcgttgcagtgggataatggctaggaggatttgag

>ycf3 [prot=photosystem I assembly protein Ycf3]
taataaaaagaaaacaaggagtaattttgattatgcctaggtcgcagagaaatgataattttattgataaaactttcacaattctagcggatattctcatacgaattctacctactactaagagggagagggaagcttttatatactacagggatggtatgtcggcccaatcagagggagaatatgcagaagctttgggaagttactacaaagccatgcgtttggagattgattcttacgaccgaagttacatactctacaatataggtcttattcataccagtaatggtaaccatgcaaaagctttggaatactactttcaagcgttggagcgtaattcctttttgccacaagcttttaataatatggctgtgatctgccactaccgaggggaacaggccatttatcaaggagatttagaaatttcggaagcttggtttgatcaggctgctgagtattggcgacgggcaatagcactttcccccgacaattatgccgaagcacagaattggctgaaaattacgggacgcttctccccgtctcatcggtgggagagttggaacaacagtacgagagtagcgtgactt

>rps4 [prot=ribosomal protein S4]
gaggacctcgtctaaaattgatgcgtcgtctaaaaaatttgccaggacttacgggtacgggtaagagtaatacgtctaacttgggggaatttcgacttgctgttgaccaatcaacgtcgagaaagatttctcaattctgcgtgcgtttggaagccaaacagagattacgtcttaactatggattgacagaacgccaattactaagatatgttcgcattgctagaagaactaggggttcgacaggtcaagttctgttgcaactgcttgagatgcgtctggataatattatttttcagttaggcatggcttccacaattcccgctgcccgacagctggtttgtcacagacatattttggtaaaccatcgcgttgtggatataccaagctatcgatgtaaacctagggatattatcagtattcggaaccgaccaacttctgccaatgctctgaagagtgagtctctcagtgggaacgaagtaccagatcacctaactctgtctatttcgaaaacgggtgaaccaacgggattagtcaaccatctggtcaaccgggaatccgttaatttggatatcaatgaattgttagttgttgagtattactctcgaaaagcttagtagaagaagcttttatt

>ndhJ [prot=NADH dehydrogenase subunit J]
aaagaggtgctaactaacatgaacaccgttgataaagagaagtttaatctaaaaacgcgaggtcgattatctgcctggttaaccaaacacaatttctcacatcgacctttgggttacgactacagaggtgtcgagattttggaagtcaagtcggaagagtggttgtctacagctgttgccctatatgcttacggattcaactatctacggtctcaatgtgcttacgacgcaacgccgggggggtctctagttagtgtgtatcacttgactcagatgcaagaccagtcggatcaacccgaggaaatatgtgtaaaagtctttgtttcaagaacaaatcctcaaataccttcggtttattgggtttggaaaagtgccgaattccaggaacgtgaatcttatgacatgttaggaataatttatcaaggacatccgtaccttaggcgtatactaatgcctgaaagttggattggctggccgctccgtaaggattacgtggtacccaatttctacgagttacaagatgcctactaaattgaa

>ndhK [prot=NADH dehydrogenase subunit K]
cgaaaaggagcattggaatggtgttaacttccgaccatttagataaaaagaacataaggaaaattgaatacaaaggtgaagactctttctcaaattcgatgtcaaagctgcctcttcaggggggtatgtcagactcaatttttatggctagtattagtgatttttctaactggtccagactctcgagcttatggccccttttatatggtaccagttgttgctttattgaatttgcttccctaataggttcgcgatttgattttgaccggtatggtctggtacctagatctagtcctagacaggcggatctaattgtcaccgctggtaccataacaatgaagatggccccatctctgataagactttatgaacaaatgcccgaaccaaagtatgtaattgctatgggagcttgcactattacgggagggatgtttagtacggattcctacagtaccgttcgcggggtagataaattaattcctgtcgatatttatttgccgggttgcccgcccaaacccgaagctatcatggatgccgtaacgaaactccgcaagaaaattgctcgaaacagatttgtgaaccgggcgtctcgccccatccgaacgaagtactttagtataagccaccaacttaatctcgtaccgggcacctgtgccggaaaatacaattgggatagagaaaattgtggtacgaaattggcgccagccaatttttcggaaaattgtcaaaagtttgcaaatgaacacgatgaattaaaatcagcaatttaatgattaattctactcttt

>ndhC [prot=NADH dehydrogenase subunit 3]
aggagtatgtggatgtttttatctcaccaatatgactctttctggatttttctattagtctgtatatctattccacttttggctttttctattaccaggtttgccgcccccccccgggaggggccagaaaagtcaacaagttacgagtcaggtattgaaccaaagggagacacttggattcgatttcagatacgttattacatgtttgccttggtatttacggtcttcgatgtcgaaaccgtatttctttatccctgggctacatctttcgaggaattgggcttatttgcattcgtcgaagtaattgtattcatatttatactaatcgtcggcttggtttatgcttggcgaaaaggagcattggaatggtgttaacttccgaccatttagataaaaa

>atpE [prot=ATP synthase CF1 epsilon chain]
ccgccgcaaaagccgcggctttgcaagcggggggtcaataagaggtatggtattaagtctttgtgtaatggctcctaatcgaatagtttggaattctgaggtacgggaaattattttatccaccaatagtggtcagattggcatactacctaatcatgcacccctccttgcagctttggatatgggggttttaaaaatacgtagtgataagcaatggtctgcaatggcactgatgggtggcttcgccatgatagataataatcgagtgataatattagtcaacgaggcagagagagctagcgaaattgatcctgaggaagctcgaaaaagttttcaaacggctcaagccgagttagctgaagcagaaggcaggagaaagctaatagaagccaacttgacatttaaaagagctaaagccagattggaagcttcaactatcgtttagtttgtcttttcttttgtaaacctaata

>atpB [prot=ATP synthase CF1 beta chain]
ttctatcgatttagcaactaaataaagaataaaggaaacacaccgaaacagttatgaaaatcagttctctccttttcgaaatttctgaattggtggaaaaaaacgtgggctacatcacccagatcattggaccagtattggatgtagctttttcccctggggaaatgcctagcatctacaactcactagtagtcaaaggacgaaactcggcgggccaggagattaatgttacttgtgaagttcaacaattgttaggtaacaatgaagtaagagccgtagccatgagtgccacagatggtttaatgagaggtatgggcgctgttgatacgggagctcctctaagtgttcccgttggtgaaactactctcggccgaatattcaatgtcctcggtgaacccgtagacaatttgggtcccgttcaaaatagtgcaacatttccaattcacagatccgctccggcatttacccaattggataccaagctatcgatttttgaaacggggattaaagttgtagatcttttggccccctatcgtcgaggtggaaaaattggtttatttggcggagccggagttgggaagacagttcttatcatggaattaatcaacaatattgcgaaagctcatggaggtgtatctgtattcggcggggtgggggaacgtacacgtgagggtaatgacctctacatggaaatgaaagagtcaaaagttattaatgaacaaaatatatcggaatcaaaagtggctttggtttatggtcagatgaatgaaccaccgggagctcgtatgagagttggcttaactgctctaacaatggcggaatatttccgagatatcaataagcgagatgtacttctgttcattgacaacatttttcgcttcgttcaggcggggtcggaggtctcagcattacttggtagaatgccttcggccgtgggttatcagccgacccttgggacagaaatgggatctttacaggaaagaattacttctactaaggaagggtcaataacttccattcaagctgtttacgtacctgcagatgatctaactgacccagcccccgctacaacatttgcacatctagatgctacaactgtgctttcgaggggcttagcggcaaaaggtatctatccggccgtagatccgttagattcgacttcaactatgttgcagccttggattgtaggtgaggagcattatgagacggcacaaggggttaagcaaactttgcagcgttacaaggaacttcaagatattatagctattctcggactagacgagttatccgaagaggaccgtttgactgtagctagagctcgaaaaatagagcgtttcctatcacaacctttttttgtagcggaagtattcacgggttctccgggtaaatatgttagtttaccagaaacaattaagggatttcaaatgattctttctggagagttggataatctccccgagcaagctttttatttagttggcaatattgatgaagccgccgcaaaagccgcggctttgcaagcggggggtcaataagaggtatggtattaagtct

>rbcL
ctcctcattacaagatttactatttcagtcatagggaggaacaaactcatgtcgccacaaacggagactaaagcaggtgttggattcaaagctggtgtcaaagattaccgattgacctattacactcccgaatacaagaccaaagacactgatatcttagcggctttccgaatgactccacaacctggagtaccggctgaagaagccggagctgcagtagctgcagaatcttcaacgggtacatggactacggtatggacagacggacttactagtcttgatcgctacaagggccggtgctacgatatcgaacccgtagctggagaggagaatcagtatattgcatatgtagcttatcccctggatttatttgaggaaggttccgtcactaatatgttgacttctattgtaggaaatgtctttggctttaaggccctacgcgccttgcgtctggaagacttacgaattcctcccgcttattccaaaacttttctaggcccccctcacggtattcaggtggaaagggataaactaaataaatatggacgtcccctattgggatgtacaatcaagccaaaattgggcttgtccgccaagaattatggtagagccgtttatgagtgcctccgcggtggacttgattttacaaaagatgatgaaaacgtgaattcccaaccgtttatgcgatggagagatcgattcttatttgtagcagaagctctcttcaaatcccaggccgaaaccggcgaaatcaagggacattacttgaatgccactgcgggtacgtgtgaagagatgatgaaaagagctgtttttgctagagaattgggtgcaccaattgtcatgcatgactacctgacgggggggtttactgcaaataccagcttagccttctactgcagagacaatgggctacttctgcacatccacagggcgatgcatgctgtcatcgatagacagaaaaatcacggtatacattttcgtgtattagccaaggcattacgcatgtccggtggagatcacatccatgctggaactgtagtgggcaaattggaaggcgaacgagaagttaccctaggatttgtcgacttactccgcgacgattacattgaaaaggatcgtagccgtggcatctattttacccaagattgggtatccatgccaggtgtattccccgtagcttcgggaggtatccacgtttggcacatgcctgccttaaccgaaatttttggggatgactccgtcctacaatttggcgggggaacattgggacacccctggggaaatgcacccggtgccgtagctaaccgagttgcattagaggcttgcgtacaggcccgtaatgaaggccgcgacctcgcccgcgaaggtaacgaaatcatccgtgaagctagtaagtggagtccagaattagctgccgcatgcgaaatatggaaagcaatcaaatttgaatttgagacaattgatacgttgtaaataagtgcaaattgccaaatttctttgctttg

>accD [prot=acetyl-CoA carboxylase beta subunit]
atacaagctaacaaaacgaatgaggagattgttatgtctgtaataaattggtttgaagataggcaaaaatttggtggattaattggagcttttcttgaagaagctacaagaagctctatgacaaatgagagagatagacgaataagcgtcaacgcaaacaagggattatgggctcggtgtgataactgtggaaatatgctttatgtaaaatttttgaaacaaaatagaagtgtttgtgaagaatgcggttatcatctttcgatgagtagtatggaaaggatcgaacttttaattgatcctaacacgtggattcctttggatgaagacatgtccgcaagagacattttaagtttctctgacgaggattcttatgaaactcgtatacttctttcccaagaaaagacaggtttaaccgatgctgttcaaacaggtataggatatctgaatggaacacttatagcacttggcgttatggacttccattttatgggaggaagtatgggttccgtagtgggtgaaaaaattactcgtttaattgaatatgccactcaaaggcttctgccactagttttgatttgtgcctctgggggagcgcgtatgcaggaagggacgttgagcttgatgcaaatggctaaaatttcttctgttttgcaactctatcaggttcaaaataaattgctttacatatccgttcttacttatccaaccacaggtggtgttactgccagtttcgggatgttgggagatataattattgccgaacctaaagcctatatcgcatttgcaggtaagagggtaattgaacaaacgttgcgccagaagatacctgacggttttcaagcagctgaatctttatttgataacgggctactcgatttaatcgttccacgtaatcttctgaagggtgttttgagcgaaatatctgggctttacttatcagttcctt

>ycf10 [prot=hypothetical protein]
tacacaactgaagttattttccatggcggcgggtaattcttcatgggcccgagcagcttttacttttaaagctacggttttcaaaaaatctagatatgtcatatattacagtcttctggaacacagatttagtctatctctttggggaatacttaaatattcagggatttatttttgtacggagatccttcggtcatttccgaaaaagcgctgcaaatcccatccctatcgtgtagacggctatccggcaggaagttgtttagatccgcctctgcatgaacctctagatacttcaactcccaagaagatatctttagtgtcttgttctaattcttacatgcgtaacaaaacagataatggaaaggtaggatctaggaatgtatcggaatacaaactcgaaggcgattttgcctctacaagtaaatccatttattacaagttaaataatctggagaaaatgaatagaaaattagcttggatcgaagccgtttcgagtgagttttctttttgggaaaaacttcgttccaaacaaatctttccatttcaaaatgaaaaagatttgattgcagaaccgtttaactacgaattagcagtttctcaccgccgtccagtaatttacgagtcaattagtttggtgcctcggtctgtaactcgtaccttatccagattcaaggcggagttaacaaatcaatcaaatttaaatttatcagtccataataaatttgatttagctaagaaccaagcctctgtttccctccaatatgttggattccttctctttcttttcccgattcaaattgctatagaaaattggtttttggaaccccggattaggggttggtggaacatacgtcaaatccaattattttcaaacgtgtttcaggaagaaaacgctttgaagcagctccgagaagcagaggcattattctggttagacgatgtgattggcaacttggcagatacgcagttgcaaaattttgatacggatgcgcgcaacgaaactactcgattagcaatgatgtatgacgagctaaatattcagctactactgcggctagcaaccaacgcaattagcattgccactttatttcccctactgatattcgggcgaaagagactcgcggttttaaattcctggattcaagagttattttatagtttaaatgacacaatgaaggcgttttccatccttctattaactgatttatgtgtagggtttcactcgccccatggttgggaaatactagtacagtcccttttcgaatattttgggttgactcccaataaatatgtaactccttgcttcgtctcaacctttccagttattttagatacgctatttaagtattggatctttcgtcacttaaatcgaacatctccttcaattgtagcaacttatcatacaatgagtgaatgacaaccattcttatgaattt

>petA [prot=cytochrome f]
ggactaattattgacctatgcaaacagcgattaccaaaaagtggatgaaggaatggtggattttatcactggcggcattaatcagttttggcaaattaagctgtccatctgtatcaaatgcatatccaatttttgcgcaacagaactacgaaaatccacgcgaagccacaggtcgtattgtgtgtgccaattgtcatttagccaaaaaaactgttgatcttgaggctccgcaatctgttcttcccgatactgtattcgaagcaattgttaagattccttacgacacgcggataaaacaagtactagcaaatggtaaaaagggggggctgaatgtcggcgccgttctcatcttacccgaaggatttgaattagctccccctaatcgtattccaaccgaattaaaaaataaattaggaaaattatcgtttcaaacttaccgacccggtgaaaaaaatataattgtcgtaggtccagtaccgggcaagttatacagcgagattatattcccagttttatcaccagaccccggtaccaataaagaagcacattttttaaaataccctatttacgtagggggaaacagggggaggggacaaatctatccggatgggagcaagagtaacaacacggtttataccgcttcagcgacgggaaaaataaagaggattactcggaaagagggaaaaggtgggtacgaaattatcattgaggagtcatccgggggtcgtgaagcaattgatgttgtacctcccggccccgaacttattgtttcggaaggtgagtttgttaaagcggatcaaccgttaactaataaccccaatgtcgggggattcggtcagggagaagtagaaatcgtactacaagatccccgtcggatccaaggtctcttagctttctttgcatcggttgttttagcacagatttttcttgtgcttaagaagaaacagtttgaaaaagtccagttggctgaaatgaatttctgattacatccttttccgggatccaccccccccc

>psbJ to psbE cotranscript [prot=photosystem II protein J-E]
CTCCTTTCCTCCATTCGGGAAACAACCGAAGTCTTTTTGATATTACAAGATAGATAGATACGGAGTTAAACATGTCTGGGAATACAGGAGAGCGCCCCTTTGCCGACATCATCACTAGTATTCGATACTGGGTCATTCACAGCATTACTATACCCTCCCTGTTTATCGCAGGCTGGCTGTTTGTAAGTACAGGTTTAGCTTACGACGTTTTTGGAAGCCCCCGGCCAAACGAATATTTTTCGGAGAGCCGACAAGAAGTTCCTCTAATAACTGGTCGCTTCGACTCGCTAGAACAAGTTGATGCATTCACAAAATCCTTTTAGGAGAAACCAATGGCTTTAGATAAAACTTATCCAATTTTCACTGTTAGATGGTTGGCTGTCCATGGATTAGCTGTACCTACGGTTTTCTTTTTAGGGTCTATATCAGCTATGCAATTCATTCAGAGATAGTTTTTGGCGAGCCTTGAATATATGACACAACCAAATCCAAATAAGCAGAGCGTGGAGCTGAATCGTACAAGCCTTTATTGGGGACTATTGCTGATTTTCGTACTTGCCGTTCTTTTTTCCAACTATTTCTTTAATTAGAATTTAGACAAAATTGTCTGGAAAAGATCGAGATCCCAATTATTTGTGACTGTTCATGTCTGGAGTCGCGGCCGGTTAACAGCTATAAAGAGAAGGAACGGGAAGGAGGCGTGGTGGCAGATGACAAATACCACTGGAAGGGTTCCCTTGTGGTTGGTAGGTACTGTAGCCGGTACACTTGTGATAGGTTTGCTGGGTGTATTTTTTTACGGAGCTTATTCGGGGTTAGGATCATCTCTCTAGAAAAA

actggaagggttcccttgtggttggtaggtactgtagccggtacacttgtgataggtttgctgggtgtatttttttacggagcttattcggggttagga

>petL and G cotranscript [prot=cytochrome b6/f complex 3.5 kDa subunit and subunit V]
tcttgtattcagatatatgttcacttTactaagctactttgcttttctgatgctcgcattaacttttaccctagctctatttgttggattgaacaaaattcagattctgTaactcattacatcattactacttctcgaagataagaggagatcaaaactagaaagggtctttaacacatatcgattactaatccgtcgcacTtaccaacaatcaattactagttaatgtgtaaggtattttggtaagtatttgtttgtatcaaatgtttacaaattgaaatggttgaagcattactctctggaattgtgttaggttTgattccaataaccctagctggattatttgtaactgcataccttcaataccgacggggcgatcaattagatattcgatgaatatctagttagatatcgtccta

>gb|AAP29411| [prot=photosystem I subunit IX]
gaaataaaaaattgataagaaggaggattccaatgcaacatgtaaaaatatatctttccacagcccctgttgtagctacaatatggtttggcttactggctggtttattaatagaaataaatcgattctttccggatgctttattatttccatttccctaacttattgttattaa

>rpl33-rps18 cotranscript [prot=ribosomal protein L33 and S18]
aagatgcaagggtaactattgctttggaatgtacaagttgtattcagagaaaaaccagtggaaaatccgcgggtctttgccgatacactacacgtaaaaatcgtcgtaacacacccgctcggctggagtTagagaagtattgcttccattgtcacaagcataccttgcacaaagagtcgaagaagtaaaaaaaaaaaaaaaaattgcaattggttcggagggaatcgatatccaacataagtaaatatcggtagttacaaagaaatatcatgaataaatctagacactcttcccgtaggcgttctccgtccattcgttctgatgaaactattgattacaagaatacgagtctacttcgtcgattcgtgagtgagcaaggcaaaatattatcaagacgaatgaatagattgacctcgaagcagcaacgtttgatagctacggcaataaaaagagcccgcatcttggccttgctgcccttttcaaataacgaaagt

>rpl20 [prot=ribosomal protein L20]
acgtataatgactagagtaaaacgaggatctgtggctcggaagtatcgcaaaaacattctcgattttgtgtccggttttcggggggctcattcaaaattgtttagaacggcaaaccagcgaaggggtaggtctttagcttatgcttatgtagataaaaataatagcaaaagagcctttcgccgtctctggattgctcggattaatgcagcagcgcggagagatggaattacctacagttcggtaattcatagtttgtacaaaaatcggattgccttgaatcgcaagacacttgctcaaatcgctactctagatgcctactgtttttctatgatcatagaaaaagttagcaaaataaaaatttg

>gb|AAP29415| [prot=ATP-dependent Clp protease proteolytic subunit]
gccaattggtgttccaaaagtgccctttcgtctacccggggaagaggatgcagtttgggttgacgtatacaaccggctttatcgagaaaggcttcttttcctaggtcaacaagtcgatgacgaaattgccaatcaacttattggtatcatgatgtatctaaatagcgaagatcaggccaaagatatgtatttgtatgtaaattcccccggcggggcagtattagccggaatatctgtttacgacgcgatgcaatttgttgtaccagatgtacatactatttgcatgggactcgccgcttcaatgggatcttttattttggctggaggagagattaccagacgtatagcactgccccacgctagggtgatgattcatcaacccgctagttcatattatgacggacaggctggagaatgtgtcatggaagcggaggaagtgttgaaactacgtgattgtataaccaaagtttatgcccaaagaactggcaaacctttgtggttaatttccgaggacatggaaagagatgtatttttgtcagcggaagaagcccaggattacggtgttgtggatctagtagcggtggaaaatgtttcacgctgaagattcattgaaaaaaaaaattacccgaaattcaattttttt

>psbB [prot=photosystem II 47 kDa protein]
aaaggggtttttcatgggtttgccttggtatcgcgttcacaccgtcgtattaaacgaccccggtcgtctaatttccgtacatctgatgcatacagctttggtctccggctgggcgggctcgatggctttatatgaattagcggtttttgatccatctgaccccgttctcgatccaatgtggaggcagggtatgtttgtcattccctttatgactcgcattggggtatcaaaatcttgggggggttggattatcacaggagatacctcaacagacgcgggtatctggagttacgaaggcgtagccgcagctcatatcatactatctggcttgctgtttctagctgctatatggcactgggtatattgggacctggatctatttcgtgacgatcgtacgggaaaaccatccctggatttacctaagatatttggaattcacctatttctttcaggagtactttgtttttcatttggggcgtttcacgtaactggtttatttggtcccggcatttggatctcagatccatacggattaactggaaaagtggaacccgtagacccggcttggggggctgagggcttcgatccattcattccaggcggaatagcgtcgcatcatatagcagcaggagtgttaggtatactcgccggattgttccatctaagtgtccgccctccccagaggttgtacaaagctttacgcatgggaaacgttgaaaccgtattatctagcagtattgccgccgtcttttttgccgccttcgtagtttctggaaccatgtggtacggatccgccgccactccgattgaattgtttggccctacccgctaccaatgggatcaaggatattttcaacaagagatagaaagacgaatacgattaggcgaagctgaaaatctcagcttatcccaagtttggtcaaagattccggaaaaattggctttttatgattacattggcaacaatcctgcgaagggtggattgtttagggcgggtgcaatggacaacggagatggcatagctgtcggttggttaggtcatgcccttttcaaggatagggaaggacgtgagctgtttgtacgccgtatgccaaccttctttgaaacatttccggtcgtcttggtagatggagaaggtgtcgtaagagctgatgtaccattcagacgagcggaatcaaaatacagtgttgagcaagtgggtgtaaccgtagactttttcggtggcgaattagatggcgccagctttagtgaccctgccacagtaaagaaatatgctaggcgtgctcaattgggcgaaatctttgaatttgatcgtgcgactttaaaatcggatggtgtattcagaagtagtccacggggttggttcactttcggtcacaccacatttgctctcatttttttctttggccacatttggcatggcgcaagaactttgtttagagacgtttttgccggcatcgaccccgatttggacgcccaagttgaatttggtgcatttcagaagttaggagacccaagtaccaaaaaacaagccgtttagaggatttcttctta

>psbT and H [prot=photosystem II protein T, H]
accaatttattccctaacccatggaagcactggtttacacatttttgctggtagccacttTaggtataatttttttcgcaattttttttcgagaacctcctaaggtgcctaacagaggtaaataaacaaaagattcctttgcctcaacctagaaaatagacacacatttctgtcttatcaacgaaattgtcgagacaaggaaaataagattaattggagaccttcttctccaatttatggagaggaaggtctccaattaatcttcatgttcttcgaaaggatctcttagttctttggacggtttaccaaaagcggtatataaggcgtaaccggtaaagctaacaagtgaacgggataaaaaagtagtgaccaaagttgcggtttccgttgccatatgacccaatagattttaattaccactcggtatactattatacaaagtcagcaaatttcaaccagttgagcagggtctatggctacgaaagttcttgatgaaactcctaaagggaaacccaaaataagttttttagggatggttttgaaaccgctcaattcggaatatgggaaagttgctcctggttggggaactactcccttgatgggatttttcatggctctattcgccatatttctagttactattttggaaatttataactcctccgtcttgttggacggtattgcaattagctggtaaaaaggaccgacccaagccccgcagctgcaa

>psbN
tggtaattaaaatctattgggtcatatggcaacggaaaccgcaactttggtcactacttttttatcccgttcacttgttagctttaccggttacgccttatataccgcttttggtaaaccgtccaaagaactaagagatcctttcgaagaacatgaagattaattggagaccttcctctcca

>petB [prot=cytochrome b6]
tttttaccactgatgtctaaggtatatgactggtttgaagagcgcctcgaaattcaggcaattgcggatgatattactagtaaatacgtccctccacatgtgaacatattttactgcttgggaggaatcacgttaacttgctttttagttcaaatagctaccggttttgctatgaccttttattaccgtccaactgttacggaagctttttcttctgttcaatatataatgactgaggtaaattttggctggcttattcgttctgttcaccgttggtcagcaagtatgatggtacttgtgatgattctgcatgtatttcgtgtttatctaactgggggattcaaaaaacctcgtgaattgacttgggttactggagtgattttagctgtattaaccgtttctttcggcgtaactggatattccttaccctgggatcagattggttactgggccgttaaaatcgtgacaggtgtacccgaagccattccctttataggatcttcattagtagaattgttacggggaagtgtgagtgttggacaatccacattaactcgtttctacagtttacacacctttgtcttgccgcttcttactgccgtttttatgctgatgcattttctaatgattcgtaaacaaggcatttcgggtcccttgtaatatctttttttt

>petD [prot=cytochrome b6/f complex subunit IV]
aacaattggattatgggagtaaaaaaacctgacttgaacgatcctgttttgcgggcaaaattagctaaaggcatgggacataattactatggagaacctgcttggccaaatgatcttttatatatatttcctgtagtaatcttagggactgttgcgtgtactgtggggctggctgttttggaaccatcaatggttggtgaaccggcaaatccatttgcaactcctttggaaatattacctgagtggtatttttttcccgtatttcaaatacttcgtaccgtaccaaataaattactaggtgttctcctgatggcgtcggtgcctgcaggtttattgaccgttccttttcttgaaaatgttaataaattccaaaatccgtttcgacgcccagtagccacaacagtctttgcaattggcaccgtggccgccatctggttaggcatcggagcaactttacccatagagggatctctaactttgggtctattttagtatctctcttcc

>rpoA [prot=RNA polymerase alpha chain]
aaggaggggaaaaaaattacgtatgcgcaaaaatgagatgtcgacctctaagcaggcaattcagtggaaatgccttgaatccaaaatagaaagtaagcggcttcattatggtcgtttccttgtatctccctttaaaaggggtcaagccagtactgtaggaattgccatgcgtagagccttgttacaagagattgaaggaacaagcataacatgtgcaagattttgcggagtcgtgcacgagtattccacaataacgggtcttcaagagacaatacatgatgttttagttaatctgaaagagattgtgcttaggggcgattcaaaagaagatattcaagaggcatttttatctgtaacaggtcctaaagaagtaactgcgggcgatctatcattaccacctggcgtcgaagcaattgacaattcgcaatatatagctaccattacccaaccaatatctctaactattgaattagaaattgaaaaagattgcggatatcgtatagaaaatctagcgaaatccggaaagggacaatttcccatcgatgctgtatttatgcctgtccgaaacgtgaattatagcatccatctatttggaagtggtagagcgacgcaggaaatcttattcattgaaatatggactaatggcagtctgacaccacacgaagcacttaggaaagcttctgaaaaactcatggacttgctaaccaccttcttgtatgtaaggggcggagacgtatctctcttcgaaaatggcgaagattctcttgatttgacgaaatcaccatctttacaacctcaatttggtgatacgaataatttggaagaaagggttttagaaaataggtttattgaccaattggaattacctgccagagcttttaattgtcttaaaagggccgaaatatacacaattgcggatttgcttaactatagccgagaagatctgtcaaaattaaagaatttcggtagaaaatctgtggatcaagtgtccgaagcgttgtgggaccgttttgcaaaagaattacccgacaaaaaaatagttctcaatcggcggaagtaataaaagaaaaat

>rps11
cgtgggggaaaacgcggagttcaaaaaggagtcattcatatacaggcgagtttcaataacactatcattaccgtcacagacgtccggggacaggtaattatttggtcttccgccggtgcctgtggatttaagggaacacgcaaaagcacgccatttgctgcgcaagctgcggctgagaatgcaattaaagcatcagtggatcggggtatgaaacaagcagaagttatgatgagcgggcccggaccggggagagataccgctttgcgagctattcgcagaagcggcataatcctcagtttcatacgtgacgtgactcctatgccgtataatggttgtagaccccccagaaagagacgcgtctaactagtgattagt

>rpl36 and infA cotranscript [prot=ribosomal protein L36; prot=translation initiation factor 1]
taggaggtttacttattacaaatgatgaagaaacagaatctcattgacatggaaggtacagttacagaatctttacccaatgccacgtttCgagcgtgttTggataatggatgtcaagttttgactcatatatcggggaggatgcgacgcagttatataagaatactaccaggagatagggtaagagTtgaactgagtccctatgaccttaccaagggacgcatcatctaccgccttagaagtaggcatacaaacaatagtcagtagatttcggtatcagtttagattttcggcagttaaccaaaccacttctcttaccaaatttcctatcttgattagatcgaagaaacatgtagcaaacctacaggtagatttacccaattaattcaaggttatagataTgaaaatccgtgcttccattcggaaaatatgtgaaaaatgtcgattgattcgtagacgtagacgaatcatggtaatttgttgcaactcaaaacataaacagaaacaaggataataaatatttatatctgaaaaataatattaatt

>rps8[prot=ribosomal protein S8]
TTGATATTTTATGAATAATGATgccatctctaccacagttacttcaatcagaaatgcgaatacgaaaagaaaagctatgactaggataccagttactaaaatgactagaggtatcgtgcaaatcttactggaagaaggttttttaaaaagcgtcacggaacacacagagggggggaaaatctttatggatgttaaactgagatattttggcaaagaaaaaaagccttacgtggcaactattaggtacattagcaaacccggtctcagaatctattgcgatcatataagaatccctaagatcttagggggcatgggaattgcaattttatcaacgtcttatggactcattacagatcgggaagctaggcgaagaaaaactgggggggaaattctatgccatatttggtaattgaaa

>rpl14 [prot=ribosomal protein L14]
AAATCACATGATTCAAATTcaaagttatttagatgtagcagataatagcggagctcgcaagttgatgtgtattcgggtactaggaaccggtaaccgcaaatacgcagatataggtgatattattatcgccgtagtcaaggaagccgtacccaacatgtttttgaaaagatcggaagtggttagggcagtggtagtacgcactcgtagggggttgaagcgacgcaatggaatggtccttgagttcgacgacaacgcagccgtcattatcaaccaggaaggaaatcctagaggaactaggatttttggtccagtagcaagggaattgagggaatgtaattttgccagagtagtctcgttagctcccGAAGTGTTGTGATAACTAATGAAAAAAAAAA

>rpl16
attcaataaacaagccctcaatgcaggggaaaattagaacttctttcaccacagaaactttctttctctttccatccgtagaaaatttttctatggaaaagccggaatcaggaagcactgtaatagtatttcacggaaatttgaggaactaagatatctcaaattttttcctcgcaactagtcgtatggttaattgtctaactcttaatatattacgtaatgtagcatgactacaaaaaagtcaggggagagctttgagtcgactaatactgggaacgccgactcaataaaactgagatagaatgtagtactacagcttcgttgtcgaaagagagaacctaaacgtctgctcaaaaagattgaaacaacgaggaaacttccgaatctgattcaacagtgaatagtgagatctggtagttgggatggcgagggaagctgacagttttttctttggatctaacaagaaaaaaaaaagtaaagctcactctcgcccgtaaatttagtgctaaattgtaataaaattgcttctcataaacagaagtgtatgaatgaaaaactgacgaagctccgcgggaactaccagtatatcgatttacaataagtaagaagtgatgttgcagttacgaggagccggtcggaaggagacttccacatccggttctgtagaaaaaaaaaaaaaaatttgtcagcatcgattgcaaccccagacgaactaaataccgtaagcaacataggggaagattgaggggaatatccagtcgcggcaacgtagtttcatttggaaaatatgctcttcaagcccttgaacctgcttggattacggctagacagatagaagctggtagaagggcaataacccgccatgcccgtcggggtgggaaactttggatacgtatctttccggacaaaccgatcactatgagaccggccgaaacgcgtatggggtcaggtaaaggatctccagaatattgggtatccgtaatcaaacccggtcgaataatttatgaattaggtggggtgtcaaaagaagtagctgaggctgctatgttgatagccgcgcacaagatgcctatacagactcgattagtaacttcggaaaaattgtgacctttccatctaaatcagtggggg

>rps3 [prot=ribosomal protein S3]
TAATTTCCTATCAAGTTGAGGAGACACACATATGGGACGAAAGattcatccacttggttttcgactcggtgtaagtcagaagcattattcttattggttcgcccagaagaaggattatccaaagtttcttgaagaggatagaaagatacgcaatcttgtcgaaaaatatattcaaaaacatgtaaaaagtgtttctaactacggcggagttgggcatattgaaatccagcgaaaaacagatcttattcaaattaatatatatactggatttcctgatttactaattgaggaacagagtttgggaattagtcaaatgaagcaggatctgagaaaccttttagggctcgaaagtcagaatctccgagtaacattaactggtgttatccaaccctatggagaaccgaagattttggcagaacatgttgcctcacaactaaaaaatagagtacctttccgacgaactatgaaaaaaaccattgaaatggctggaagaaccaacggtgggggcatcaagatacaaatagccggacgtttgaatggtagtgaaatggctcgcgtagaatgggctagagaaggtagagttcccctacaaacggttgaagccaacataagttactgctatcacccggctcagacaatttatggagttttgggtataaagatctgggtatttCGGGATACTTAACAAATTTTATGCAAGGTAGAGAAAATACTATTTGATAGATC

>rpl22 and rps19 cotranscript [prot=ribosomal protein L22; prot=ribosomal protein S19]
cttgaccgagaagaagcattaggaaaggagtaactgttcaTggcacgttcatcaaaaagaggtccctttgttgctaatcacttaataagagaaattagaaatctcaatatacagaaaaaaagaaaattgattacgacttggtctcgtgcttccgcgatagttcctattatgatcggtcacacaattgccgtccataatggccgagagcatttgcctatttacgtaaccgatcgaatggtaggtcataaactgggggaattcgtacccacccgaaactttcggggacatgccaaaagcgataaaggatctcgccgataatctaataatctaattaggaaattatatttcatgggaaacgtaattaaatcgcaagttggagcgcaagctctagggaagaatgtccgtgtgtcagttaccaaaatgcaacgtattatcgatcgaatacgaaattgctcatatgaagaagcacttgtatTacTcgaattcatgccctatagggcatgttacccagtatcacagctggttctttccgcagctgcaaatgcaagtaataatcttggactgaataaatccgatttgtttgtcagtaaagcttgggtagataactccaaatacctccgaagatttcgtccacgagctcaggggcgcggttaccccataaaaaaacccacgtgtaaagtaactattcaattgagctcaaagtctattgagaagtgaataa

>rpl2 [prot=ribosomal protein L2]
TCCTATTCAAGGAGGAAAAAGAGATATGGTTATGCGAtcctatagggactataccccgaatgcccgaaagcaagacataccagaagagggaagacataaaccctgtaagaaattaactcgcggcaaaatctctggaaatgggcgcaataataggggagtaataacaagtagacacagggggggtgctcacaagcgtctatatcgcgaaattgattttcgaaggaacaagttggatatcgttggaagagtaggaagtgtcgaatatgatcccaatcgtaacgccttcatctgtttgatcaattatgtagatggtgataagaggtatatcttacatccaaaaggaatgggaattggagacatcgttttatccagcccaaacgcatctatctcagcaggaaatgccttacctctgacaaaaatgcctttagggactattatacataatatagaattgaaatccggaagaggcgcacaattagttagatcagccggcaccgtagccaaagtaattgcaaaggaaggtcgactagctacactgagattaccttccggcgaaattcgcttagtacctagagattgtctagcaagtgtgggtcgagttggaaacgtagatatcagtaacaagggcttaaaaaaagcagggtccaaaaggtggttgggaaggagacccaaagttagaggttctgccatgaatcccgtggatcatccacatggagggggagaagggagaacctccatcggcagaaagaagccattaaccccctgggggcgagtcacactgggtaaaagaagtcgagggaaaaaatgtatcaatcctctcatacttcgtcgacgcAAAAGTTCTTGACCGAGAAGAAGC

>rpl23 [prot=ribosomal protein L23]
AGGGGGATACTATGGATAAATTAaaaaatcaagtaattactggaaagtctattcgtttattgcaacagaatcaatatactttccaagtggatttgaaactaactaaaactggaatgaaagattggatcgaacgattttttgacgtcaaggtggaaggtataaatagtagtcgaatgacaagtaaaaatgggaaaaaaaaaaataaattgaatattacttacgtaagctataaaaagatgattgtaagactaaaaaagaattatttcattccattatttatgAGTCAgACTTAATTTTTGTTTTaTTCCCaC

>rps7 [prot=ribosomal protein S7]
aaaaaaaattggttgaagtctgacgtagttgtaaactcgtggtacatcggagcagtgtagtgaacgaaattagaaatatcgaatcggatccaatttatcgcaatcgattggcaaacatgctagttgatcgtatcctgaaaaacggcaaaaaatcactagcttatcagattttttatcaggctatgaagcggattagacaaaagacaaataggaacccactgtctgttctgcgacaggcagtgcgtggggtaactcccgatgtagtcacagaaaccaaacgtgtgggtggatcaacttatcgagttcccattgaagtagtacctgcaaaaggaaaagctttggccatccggtggttattgatcgcatgtcgaaaacgctcaggtcgaagtatggctttaaggttgagtgatgaattgatagatgccgccagaaattctgggagtgccatacggaagaaggaagagactcataaagttgcggaagctaacaaagcttttgcccacttccgttagttttgcttagatgagattagttccaatccacaatcttttc

>psbA cDNA
ctaattccttttcgaaaaccaaaaattcccatgaccgcaactttagaacgacgcgaaagcgcaagcctatggggtcgcttctgcgactggatcaccagcactgaaaaccgtctttacatcggatggtttggtgtcttgatgattcccaccctactaaccgcaacctctgtattcatcatcgccttcgtcgcagctcctcccgtagatattgacggtattcgcgagcccgtttctggttctttgctatacggtaacaacattatctctggcgctatcatccctacttctgcagctattgggttacacttctacccaatctgggaagcagcttccgtcgatgaatggctttacaatggtggtccctacgaactgatcgttcttcacttcctacttggtgtagcttgctacatgggtcgcgaatgggaactaagcttccgtttaggtatgcgcccctggattgctgtcgcttattcagctccagtcgcagctgctgccgccgtcttcctgatctatccaattggtcaaggaagtttctctgacggtatgcctctgggcatttctggtactttcaacttcatgatcgtattccaggctgagcacaacatccttatgcatcctttccacatgttgggtgtagctggcgtattcggcggctctctattcagtgctatgcatggttctttggtaacttctagtttgattagagaaactactgagaatgagtctgccaatgcaggttataagtttggtcaagaagaagaaacttacaacattgtagctgctcacggctacttcggtcgtttgatcttccaatatgctagcttcaacaattctcgttctctacacttcttcttagctgcttggcccgtggtaggtatctggttcaccgccttaggcatcagtactatggcattcaacttgaatggttttaacttcaaccaatctgtggttgacagccaaggtcgcgttataaacacctgggctgacatcataaaccgcgccaacctaggtatggaagtcatgcatgaacgtaacgctcataacttccccttagacttagcctctgtcgacgccccttctataaacggataatatccgtctg

>gb|AAP29436| [prot=hypothetical protein]
GAACTAATATgggaaaaaagctatggtaaaaaaggtgatagaaaaaggaagaggagtaaggggccgagattattcatctaaagtttgggacttcttagaaatcgatgcattaaactacttctccgaatcattgaaaaaccactatctcgaagaacttgtagttagtccagcttccactgctgaacctttcatcagattatctgacttgcgatttttaagtttactgtttctacgtaatctgcgtcattcaataatgaggggtagtggcgtcaccctggaaatgctgatgttgctggcgataccaatttttatgcattgcctgagttacaaaaattcgattgataggggttttgtattagcaaaagtcattgatggaggtgaggggataagaaagaaacagacggaaaattatggcaatttctcctacgattgcttcctccaattcaagagatttttatccgtcggaagagatgggaagagagaaatactggagccctactacttaggtttgaacaaagatatttcaatttctgcaagttcttcaaaggaggaaagagaaatccgttatgatgtcacgactcccttgccttccggtaggtggaaggcacgcataatgaggagggattccctactatttggcggggatagattcaaggggaaaactgaagggattcaagtggttcgtgggggtaggtatctgcaagatttagttaggtttttcaaattctataaaaacttggtagtttccaaaaacggaagtgactgccaccaaaacaattttgattcgttgcttctccgggaaatctgtgacaagcaagatctgggtcggttacaagcaatacggttgggaaacaattcattaagttccgtagtattgtacccctttgaatctgaatccgcagattcagccgatccccggagggacggatcggcatttccctctgagcaagaagtcttttccaacttgtattcgtttacgtctcgtgagaaaacaatattgtttcgcaactctatatctggattagattatggagaagatgagggaggctttcccgttctacatgcttattcacaagttagaaatcaattaataaaccgactcaccaacttcctttcgataattaggaaatcaaaccttcctcttggtgggaaaatagttattgacgtcagtaataggatcaaatccgagagagtcttttttccatcgggaatgaaaaaaaatatgccgtttaccaaaatatctggcaagaaacttaggttagcaagtggcggatacttcgacttcgttgagattttcccaacctattttaaagcatccttagagatacctagggaaacaactaatcaaaatggaaatactaattttttagacgaattggaaggaggggggaacctagattcaatttattctctagttagattatatgggcgaaatagaatcatacctctctactcaacatacatatttcttctccacgattatttttgtgcgttatccactgaatatttcttccgaatcaaatattggttggatggctggacgggtggcagagtatacatcagtttcacgggaattgcaactgaagaaacagtattcaagtggaaggatgacgtagagcgtctatcgaacgaatatgttacctcccatattggtcagtgtaggaatgttcaatcaaatctgtatagacggctcgatgcaacacggaatttgtatgtttcgcctgttaagaaattcttgggagaagcaatgaagtacaacttggcagaattaatctgccgtgtgtcactagtgggaaacgagttgctaaataagactggtgtcagtctccgtagtaccaatagacataccaagaaatattttcaccgatttctcgatgtgttatttctttccaaaatgattgttgctgaggctactcgccagaaaattctgatagataccgttgattactgcatcgaaaaattggacgacatagattttgaaaaattgaacaaaatggatcgtattgagcttgattttttctcaagtttatccgatggttacattgacgaagagatacttcttttcaaaacaattcttgaagaaagaaaaagtttcttagtcgagtctagactgttaacaagtgaaaaatcggtaggctcctcgactgcgctaaaacctgcgtcgaatttcacctctctcgggttgtcttgcatcgaagctatccgagcaggattctcgggtgaggctctttctattatggggagacaaaattggaatctgtttgtgtgtgatttaagccgtggggggaattcaattaggaatattggtgagagtcttccaaaaaacatttccgatcaaatggatgaaataaacaactcacctatacggagccgggctggaaacaactttatccagagaatcaaaaggggtttcttcgtcgggaactgtagcaatagttatctcgacgtgttagaaaacttttatttgagctccgacgagaaagccatctcctcatctgatatcctttcacttattcacctccaattgtcagattcgttatcatccaatttttcgaaacaaacggcaggggaggtagctgatcacttactcacaccaattcaacttatttcgcctaacctgcatgaatccgcgaccatagtaactcatttggatggacttcccaattctatttcggatctgaatgggttactggcaagtttgagctcatccccccgtgaagcgacagactcgttcctattttcgtgtagtaatgatggagtttctttggaggaggcgtcgagaaactccgactcgtggtcggatcatcagcgaacccaacctcgtcggaatctgctggtattagatcgagtcaattcggagaagtttttcaaagatggattagactcgagaaatggttcccccacgagtcaagtctatcgaaacgggttgtctattgagtatttttgggaaccgaaaaaattggatacaccttattggtcgctaagattctcattattcaatggcgtaacatcaagatttatagcgggatcaattggggaggatgttacccgccaagatgcggggttcgcagattcatctgcccgggaagaagctacttgcccgtcccatttcatcaatttcaatgaattatcagaagatttgaacagatataagatctcttggattttctggagagacagtatcggcgaaaattggagcttattgggagattatatacccctgttttttacccccacctggtggagatacttctgcgatctaattacaaaagcatatccggaaatagtacttaagataagttacgactcaaatcatgatcttcgtagaatttctgaaggaattgctaggggtttagtaggtagcgcgaagggctatttactccgaagcctgcaaaggctaggattgatattcggaaacaattctattaatactatatcatccgagacagatcttctcattctcgaaaaaatccctgataaagcggagattttacatccgggggaatggtcggtatctcaattttccaataggcctatctcctattgctgcatcctctcaatattacttgttctcctgtcattgaaacatcctttgtctgccgtttcgggttccaatttctttcatttgtggaaacgttttgctactattgactatttaacagacccaatgcgtggatcctatttgagaaaggtaatgtattcccccccgacaagccaaatgttaacaagagatctactaattcattctctcaatagattcttgaattgtgtaagcaatatactttttttccttttcgtgaaaaatgaaattgattcgtggatatttcgtagagaaagctctgatattttagatagtaataaagaactactgactcaacatttggtaacgactaagattctctacaggtatgcatcgaaatcaaaattcaattatgatttatcgagcaacaagatttttcatgaaccttacccgcaagatagatccaacgttttggcatacttacttcaattctggcaaaatgatctattgggtcacaagattcgtaagttggatcctgcggagaagtgggctttttccgcccttgggagagatattctattttcggcaacaacaaggcgaagagacagtctactaaatatgccatgtcgtgacatacctatttcactccaatcgggattattaccatccaaaggaattttgctagtaggacctgtagaaactggcagatcctctcttattagagatgtagcatccaactcctactttccagtggtgaaactaccactcaaaaaattcatatacaaccgatcttttttcaataatgtacgtggaaatttcatctcgaaagagagcgtacaccgattaaatatcgtctttgaaatagcgaaagaaatgtctccttgtacattatggattcaagatattcatgaattgaatatttgtcgttcgtataataagctagaagctgatcccaaatttctactttgccaaatattgaagagtattggtcacaagctcggcaactccgacatccgcgagaatgtcgttattgccacgactcacgtacctgcgaggatagatccagctttagtagctccgaatcggttaaaccaattaataaattttcggaggtccaatgggcgtcaacgtcagaaagaattgtcaattctattacgtatcaaaggtttcgaggtaggggctaatccgactcttcttgagagtactgtgtctggaactgcaggttatagtaaacgagatttacttcttctcgctaatgaagcgttattgataggtacttccaaagggagaaagtttgtatgtagcaacacaattggattagctttgcataggcaacattcgactgttagtgatatgggcaatgagatggaatctaattctgaatgggaaatctcttcctacaagatggcagaagtaaagaatagtttgacagatatttctctcacaacttttccatttattggtcgtgacgagttaaaaatgcgattttattacttgtctaactggtatgtggaaccttcaacaaccgaatcaacaattgatgaattcactatgtttttgcatctcccagagctaatagccaaattagtagctcgcgattcgttccaaatggataggggaaaagaagataatttcattgttatcgacaaactcgtagagaatgacttaaacctagcttgtggcgtcctagaaaacctctcgaataatttcccacgtccggaaatttgtaggggagagagccggcgcagtaatagttttcctccccctcttcctattggaaaacccaagtattgctcaggtgtaacctctctaagtcgctcttccaaatctctgaaaagagggagaattagtagtctaaccgatttcgagatgcaacagtcacccgaattaagaaactcagcggcagagatatcgcgtgagattacttggtcccgcaaggcttggcgtctccgtttcctgcgaagcgggacttacgaattgatgggggtattatccgaacccaaccatttgtataacttaattcttctttactacaatcagaattacataccccaacaagattttgaattcagtaagattaggggaaagagaagtaagtggcgcgagaaaagcgggtatcttttcagcttcgagaaatctgtcactaatggaacagataattccattaaaagattggaaaaccgattggataatatgttgttacgtgagcaatttctcgaattgggaatctctggcgattcatctaatgagtatgaaacacattgtgatcgattgaatgaaatgactcgactcttcggggggcgcttcatctgggaccccatgcttctgttccagccagaccctaacattccttccctgcgccgcaacttgttgtcaacgaaagaactggcacggaggcttcacaccatttacggtatgagaaggcagcgccttcagaagatgtcaaataataaaattaaagattttttcctctatagcgaagagaatccaaaattgaaacccgactcatctctcaatcggcggaataatcttcctctggaagaggaggagcgagattccgaatacgtcagggaaacctcttccgtagatatacatctgcaatatccgcagatatttactcccgttcgtttgggttgctacgcggtagcggaggatttcccggaacgatttcttcggtttaggcttctggttcatagaaacaaatggctgagacggaaccgttccccatttcgggattttcttatttataatatgttgcttgaaacttatgaatatctatccaatccgtttcggtttggtaaagcatcactggattgaacaatgaaacaaTTCCTTCATG

>ndhF [prot=NADH dehydrogenase subunit 5]
attaaatttggagttgactacgtctgtgaaactttcaaacgaatacgcttggattattcctttgtgtccattaatagcttcttgttgcactggatcgttatcattcttttttccaagagttgcaaggggtttccatcgcctgtgcgcattgctcaacgttttttcattagctatttctatgtttgtgtcacttgccatatttcaggaacaatttgtgaaaaacccgattcagcaatatttatggatttggataccgagaagtactttttgcgtagaaataggctttttagtcgattcacttactttagtaatgtcactactggttaccactgtaggcgtgttagttatgatttatagcgatagttatatgtgttatgaccggggatataccaggttttatgcttatttgagtttgtttactgcgtcaatgttagggttagttctcagccccaacttaatacagctttacgtgttttgggagttagttggaatgtgttcctatctattagtaggtttttggtttgctaggtcaagtgccgcaaatgcttgtcaaaaagcttttgttaccaaccgcataggagattttggattacttttaggtattctaggtatttactggacaactggtagtttcgagatttccgaattgtgtgatcgatttgccaaattaaaagaaattggattttccaatccaatcttgacaaatatcattgcttttttactccttgcaggtccagttgctaaatctgctcaatttccgcttcacgtatggctgccagatgcaatggagggacccacgcccatatcggcccttattcacgcagctactatggtagctgccgggatttttttcattgcccgaatttatggtctaatttctacgcttcccttagtgatgcaagccagctcttggcttggtggagcaacggctttgctgggtgccacattagctcttgcacaaagagatctaaaaaagggtcttgcttattccaccatgtctcagttgggatatatggttttagccctaggcatcggcgcttaccaatctgctctcttccatctcgtgacgcatgcctattcaaaagctttattatttctcggagccggttcagtaattcactcaattgaaaaagttgttggatattcacctaacaggagtcaaaacatgtttttcatgggtggcttacgtaagtacatgccaattactggaactacttttcttctgggtaccctttctctatctggaataccgcccttagcctgtttttggtccaaagatgagattattcacgaaagttggttaagttctcttccacttggaattctagcttctggcacagcaggtcttacggcgttttatatgtttcgtatctatctccttactttcgagggggatttttgcactattaaaacggattgggttgactttaaccattttgcgccattgtccataagtatgtggggtgaaactgaaggaaatctttcactaaatcaaattaatcaaaatgttgcatcggtacgattgggaataacaaaaaacaaagggttttcgtcatcatatctagcaaacccaaatggaattactaacgtccattacgatcagagcttgccgaagcctaaagaatcgtcttctgccatgacattttctctagtgatgcttgcaatacccactacattagtaggactactgggaattaatctcataggagaaactgccaattttgaattatccccggagtggttaattaatccagttcactttttcgaacttagtaaatctttcaatatttatataaaaatattgctaaactcgcgtagctcacttattttatctttttttggaatatttttttccttcattatttacaaaaaaagttataaatatttttatattactaaaaaattagttggatttaccaaattagttagtaaatttgggttgcttgttcaatcttggtcactaaatcggggttatattgattactattatgatatatgctttgtgcgtaatctaagatctttaagtaagtcactttcagattttgatcgttacggaatcgacggttttgtcaacgtaatcggagccttaaatttttttggaggagagtttatacgttacggagaaaatggtaggatatcttattacttattcataattatttttggagctattttatcatcagtactaatcttcatctttttaccttttccataaactgctactttcgtttcac

>rpl21 and rpl 32 [prot=ribosomal protein L21; ribosomal protein L32]
ctcgctttgtgaacgaatttttttctttctcggggggaggaaatatggaaaaatggaaagagagagtcagaattggtggatacgcaattattgatattggaggaaaacaactacgagtacaaccgggaagattctacgatgttcgtcattttccctcaaatttaaatacacggggatctgacacaaaagtatccatgggtcgagtcttgcttattcgtgacggatctaaaatagatattggttctccgtggctagcgaatgcagtcgtcaagggacggatcttacataactgtttcgaagataaattggtaataaaaaagattttttccaaaagaaaaacgcgagggagtcgaggatgcagaggaagtataattagatttgcaattgattccatccattttaattgtagtaatgcaactaacaaataattgcataggtaagtcaaattactaagatacttgaaagattgatgcatcgatgcaaagttttttttttatttgatatctgtccctctttgttatttgtccacttttctatccattatattcattctactgatacatatcaacataactggtaattgcaaagagaaaaagctacaagaatactcaatagaatatggccgttccgaagaaacgtacttctgcatcaatgaagaaaattcgtaatcatagctggaaaattaaatcagtggaaaagtcgttgaaatctttttctttggctcaatctgttttaagcggacgttcaaaaagtttttattatggaactgaaaaaa

>ccsA [prot=cytochrome c biogenesis protein]
tcaattatgatatatacaggcatagagtacatatttgttaatatttcgtttgtgatgttttttttcgtaactttgttgaacctcatcaatttattttacaaaattgataaaattgatcatttcagcaaaaatagcatgacaattgcttttttctgtactacaggatttctgattactcgctacctccaaaccaggcacttaccgctaggtaatctgtacgagtcgctaatgtttctatcgtggggcttctccttattatatttaattttagaagttagagaccaaattggtttatcgcatgcagtactcgcacctggtgctatgttgattcacgccttcgcaactttaagtcttccccagcaaatgcgttcccccacgttgttagtacccgctttgcagtctcagtggttaatgatgcatgtaagtgcgatgttgattagttatataaccttattgtgtgggtctttgctagcaataactttattaagtttattctacggcaaggtaggtagtgtaactttggaacacaagtttgaaaaacaatctttcttttttttgatgaaccctcgtaagaatctgtggaaacaaaccggtgcagaaaactattcctacttcctcatctccaactcacggaagtgccaattgattaattgcttggataagtgggcttgccaaacaataagtttggggttttctctgttgactattggtatactttctggcgcagtgtgggctaatgaagcttggggatcttactggagttgggacccaaaagagacttgggcgttggtaacttggttagtatatgctatttaccttcatacaaaggtggataagagaaagatgggggagggaccggccatgacagcatctatgggatttttcttagtttggatttgtttcttgggagtcaatttattaggagttggattgcataattac

>ndhD [prot=NADH dehydrogenase subunit 4]
cagtctctattaaaaattatttcttttttaattcatgattagtaatgtaccttggttaacggtaatcgtttccctcccaatttttgctggtctgatgattccaatcctgcctcgtaatggaaacagagtcactcgatggtatactctgggtatttgcatattggaatttttactaattacttacatattttattgtcattttcgaatcgattatcagtcaatccagttgttggaaacttttaactggataaacaatatccatcttcactggtcattaggaatcgacgggctttccctcggtcttgtcatattgacgggttttgcaactactctggcaaccttatcggcttggcctatcactcgtaatacacggctattttactttttaatgctgattatgtatggcggccaaattggattatttgtttcccgagacattttgctttttttctttatgtgggaaatagaactcattccagtctatttactactatgtttatggggcggaaaaagacgtttatactcagccacgaaatttgtcctatacacagctggtggctcaatatttttattggtggcggctttgactatgagtttttatggtagcgaggttccttcttttaatattcaggatttgatacataaatcatatcccctttcgttagaagtactaatctacgtaggtttcttggtggcttatgccgtgaaattgcctatctttcccttccatacctggttaccagatactcatggggaggcacactacagcacatgtatgttattagccggagtgctgttaaaaatgggtggatacggacttattcgaattaatttggaattattaactcatgcacattttttacttggatcgtggatgatgttatttggagcgattcaaattatatacgcctccttaatttcaatgagtcagcgcaattttaaaagaagaatagcttattcttccatttctcatatgggttttgtaaccatcggaatcggttcttttacagagacaggtattaatggagctatattacaaatgatttcccacggtttgattggagctgccttatttttcctcgcaggtacctgttacgacagaactcgaacttatctactagatcaattgggaggggctgctatttcaatgcctaaattatttaccatgtttagcaccctttcgttggcttctcttgcattaccgggaatgagtggtttcgtgtcggaattgctagtttttttgggagttgttacttctaatcaatattcttttgcctttaaggcgggaattacggtgctagagggaattggtacggtattaactcccatctacttactatcaatgttacgccaactattttatggttacaggttttttgacaaatcaaatccttactcaattgatcttggtccaagagaattatttattctaatttgttttctcctaccaatactaggtatcggtttatacccaaatttgattttatctattgggagtactgaaatcccttccctcccacttacatgactcaacgttctgagctaaaaa

>ndhE [prot=NADH dehydrogenase subunit 4L]
ATTTAATAGATCATGTTTGAACAAggactaattctgagtgcttatcttttatgtgtaggttttttcggtctaattacgagtagaaatatggttagggcactgatgagtctagagctaatctttaacgcgattactttaaatttcattacactttcaaatctttttgacaaccgagagactggggaaatatttacattatttgtaatagccgttgcagctgctgaagctgctaccgggttagctattgccctttctatacatcgaaacaggagatctactcgtatcgatcaatcgaatttgttaaaatggtgattgattgataggttatacagttttaaacaccta

>ndhG [prot=NADH dehydrogenase subunit 6]
AAAAAAGGAAAAATCAAGTATTCACTATGAAAAAATTCAGCTGAAACACTTAAGTAATTGTGTCTAATGAATATCTCAgaattaattcacgattttgttttagcactggtagaattgggtatcctgctgggaagtttaggcgcagtattacttgtcaatacagttaattccgctttttctctggggttggttttcacttgtatatctttattatactttgttttgaatgcagatttcgtagctgctgcgcagttgctagtttatgtaggagccataaatgttttaaccgtatttgccgtcatgattactgatgaaccggcaggttctgagactactgcccgtggcataggctatatcattactgcagggacttgcacaatccttttttcaatattatcttttgtgattcacaatactaaatggtctgacttaagtctcattcctcaatcgggaatttctacatcaggcacactcggaagtaatgtccaacaacttggatataaattattgggagaattcgtaataccattcgaacttctctcgatacttctcctagctgctttagtgggagcaattaatctagcacgcaatgaagatgcatttattgtcaataagaaatcagctgcttcagcaccctacaaaaattctACATTT

>ndhI and ndhA cotranscript
TGGGAGAGGTTGATCGTTAGAATGATAAATAGTACCGAATTTTGCAGAAATAAACTAATTCATCTTTTTGACGAGTTAGAAATTACAATGAATCTTTCCAAATCAATTTGGATTTTTGCTTCTACTCTTCTTCTAGTTTTGGGAGTCACGAtGGGAGTTTtAGTAATTGtATGGCTCGAAcGAAAAGTATCCGCGGGGGTTCAGCAACGAATTGGACCAGAATATGCAGGTCCACTAGGGATTATTCAATCCCTAGCTGATGGAATTAAACTTCTTTTAAAAGAAGATATCATTCCAGCTAAGGGTAATGCCTGGTTATTTGCCGCCGGACCGGCTGTCGTAGTCACACCAGTATTTATTACTTATTTGGTAATACCTTTTGGCCAACATATCATATTATCCGATTtGGGAATAGGTGTCTTTTTCTGGATTGCTATCTCAAGTATTGTACCCCTGGGTCTTCTTGTGGCAGGGTACGGTTCAAATAATAAATATTCTTTTTTAGGCGGTCTCAGAGCGGCGGCTCAATCTATCAGTTACGAAATACCCCTAGCTCTATGTGTACTGTCGATATCCCTACTATCCGGTAGCTTGAGTACAGTTGATATAGTTGAGACACAATCCAAATATGGTTTTTGGGGGTGGAATCTGTGGCGTCAGCCAATAGGATTTATAGCCTTTTTCATCTCTTCATTGGCAGAATGTGAGAGATTGCCATTTGACTTGCCAGAGGCGGAGGAGGAGTTAGTGGCTGGTTACCAAACTGAATATTCAGGAATAAAATTTGGCTTATTTTATGTTGGTTCTtACCTAAATTTGTtAGCTTCCTCACtATTTGTAGTAGTTCTCTATTTGGGTGGATGGGATTTCTCAATTCCTTTTGTCGAAAATTTTGGACAAATTGTTTCAACTTCAAGTGTCATTGACAAGTCTCTCGACACGTTGAAACCGATTGTAGAGGTTGCCACTACATTATCCAAATCCTATTTTTACCTATTTTTCTCCATCTTGACAAGATGGACTCTACCTAGAGTCAGGATGGATCAATTACTAGATCTCGGATGGAAATTTCTACTGCCCATTGCTTtGGGAAATTtGTTGCTGACAGCTTCGTTTCGAATATTACTCATAAGTTGACGCATCCGCCTCATTTTCAGTTCAAGTTAAAACTATTGAATTTAATGTATGGAAACAAACGCATTACCTGTCCTCCCCTGTCACATGAAAATGTGTATCGAAAAGTAAATTTGAAATTGGATTTATCAATTTTATGTTTTTGGCAATAATTAAGTTTCAAAATTATGGTCAACAAGTTCTCGAAGCCGCAAACTACATTGGTCAAGGATTTGCAGTTACCTTGGATCATTtGAATCGTTTACCCATAACTGTTCAGTATCCATATGAAAAAAAATTACCATCCGAACGATTTCGTGGACGTATCCATTTCGAATTTGATAAATGTATTGCCTGCGAAGTAtGCGTTCGCGTATGCCCGATCAATCTCCCAGTTGTCGATTGGATATTCCTGAAAGATGTGAAAAAGAAAAAATTGAAAAACTATAGCATTGATTTTGGAGTTTGCATATTCTGTGGGAACTGCGTTGAGTACTGCCCAACAAATTGTCTGTCGATGACCGAAGAGTATGAACTTTCCAGTTACAATCGTCATGAACTCAATTTTGATCAAACGGCTTTGGGGCGTTTACCTCCTCCCGCCTCTGAAGATGTTTCAATTCAATTAGTTTTGAATTCAAGAAATTCTTTTAGGAGATAAATCTTGAGA

>ndhH [prot=NADH dehydrogenase subunit 7]
CAGAGGTTTATGATATTTAGTGGAGAGGAAGCAATTTAYGAGTATTCGTcttgaagatattgatccagttgtagtaagcatgggtcctcatcatccctcaatgcacggtgttctccggcttgttgttgctttgcagggtgaaaatgttgttgattgtgaactaatattgggatatctgcatcgaggaatggaaaaaattgccgaaaatcgaacaacttcgcaatatcttccctatgtgacgagatgggattatttagctactatgtttactgaagcagttacggtcaatgcaccggaaaaattggcaaatattcagatacccgaaagagctagttacatacgcgtaatcatgcttgaattaagtagaatagcatctcacctgttatggctcgggccattcctagcggatatcggtgcacaaacccccttcttttatatatttcgggaaagggagatgatttatgacttgttcgaggcggctacgggtatgagaatgatgcataactactttcgaattgggggagttgccgcggatttgccatacggatggatcgataaatgcttggatttttgccaatattgcctgccaaaaatctatgagtatgagcgattagttacgaaaaatcctattttcttaaaacgagtgcagggagtaggtttcataaacagacaggaagccatcaattggggattatctggaccttcgttacgagcttcaggggttcaatgggatctccgcaaaattgatcattatgagtgttatgataagctggattggcagattcagtggcagggggaaggagattctttggctcgatatttagtacgaatcgacgaaatgaaagaatcaataaatattcttcgacaagctttaaaacttctcccgggaggtccatatgaaaatctagagggtcggcgtcttgtgcaaaagaaagacaaaatagattggaacggtttcaactaccagtttgtcggaaagaaatcttctcctactcttaaattgcctaaacaggaacattatgtaagagtagaagctcctaagggagaattgggaatttttttaattggagatgatagtgtctttccttggagattgaaaattcgtccacctggttttataaatttgcagattgtccctcaattgattaggggaatgaaactcgcggatattgtgacaatattaggtagtatagatatcatcatgggagagGTTGATCGTTAGAATGATAA

>rps15
CTACTAATATTACCATGAAAAAACAAGAATCTATTCACACGCAGCTTCCGGGTGAAAATGTAAATACGGGATTCACTGCTTCTCAGATTTACTACTCAACCTACCAAGTTTCGAAGCTTACTTCCCATTTGGAATTACACCCTAGGGACTATTCATCTCAAATAGGGTTATGGAAATTACTTGGTAGACGCAAGCGTCTCCTAGCTTATTTGTTCAAGAAAAATACGGGTTTATATGAAAGAGTTTTAACAAAATTAGGTATTCGTGGATTAAAAGTGAAAGGACGTTAGCGTGAAAAAACT

>ycf1 [prot=hypothetical protein]
ACAATTAGTAAAATTTTCTACACATCAAAAAAGCTGCAATGAATACAAAGatattgttgtcactgccctggccaaaactgatggatccctatatgctacttggtttctactatgggttacttacaacattacccgtgggaccttcgcaaatcctatgtgtgagatcttttcttttgggtgggaatctaagtgggctaatttctatcagtgggtcggtattggcacaactaataactgcatcatcaatctactgctcgccaatttatctattactgctaaggccacatttactaactattgtggcaataccgtatacacttctcttttgtctggtaatcaaggattttccaaattatcagattttgcgtcccgtgacatcattacgtgactcacgagtagctagattatttttgataagtttcttttttcaaatattgaacccaataatgttaccaaatagtgtgttaacaagactgatttatctatacttcttcaggtatagcaccaatacagtttttatggtatctacttttatgggttggttaactggtcaggcagcattcaattttttttctagactacttttaagtcgggtgaaaggggattccccgatattatatctagtggcgaaacgttttatatatgcaacttttagtattgtttccatctcatatgctgtggcatatttgggtagagctccggtctctttttggaccaaaaagttcatgaatgaatctcatgatagagaaatgaatctttgggaaattgctgaatattcggatctattgtggtggttttttaaaccgtggcccacttctttttttgatccctctagggcaaatcggagtaatcgatttgtcaaaaatcgtcgattccacatgaataatactttttataaggggagaacatccacatacttttttgaaaaatgtttaactgatggtaaagagagattatcttttctagcattgcccagtttgtcaatttttgggaaagaaatgtatcaatcgatggcaaagtcccgtagatcttttggaatccgtttatcatatcaaaattgggtttcaaaaaaattagcgaaaacaaaattctttgagaaagaattaacggatcaaatcaagttgttagacactggttcttcattctcaaagacgatgagtagaaaaacaagattgatgggcggtaaaaggaggagaataccccgcacctatgacccctttgtcaataacttccgcataagaattccagtttcacagacatttttgttagaagatgacttgggtttgagtctatgggaatgggataaattggcgacggaaagaaaaaatagaaaggcaaaaaaaactgtcaggataaatgctatcaaggataagattttcacaaaagatcggagatggaaacatggatatggaaatccgctaccgtgggaacctttgccgtcgagaagtaaacgcatgttctattttatatttgaaaatcgagctttatacgactacgatctacaaaatatcttgaaaaagataaaatcttcgcccacactcgatgttacttggaaagaaataatggatttagattatgaagaccatatcttatttttgacctacttagaggtgggatgctgtcaccgatttggttggatatctccactcaaagcctttttgagaaaaagttctaagagtttgtcaaatgtagaacggagaatacgcagactaaataaaattgggaatttgagtatggatctggctcgatatactatcctgtattttgaaaataattttgatataccgggaggagacggcgattttcgctacagaaaattgcgtaatgtgggtatcactttcgcaaaaggaaagcccagatcagaaagattaatgaagcgatatgcaaaagtatctgatttccgtagaaaatttctgaagggctctatgcgttctaggaggcgaaagaccttgctctggaaagcacttcaagaaaaaatacgttcgtcttttttcctcagatcagcagaaaggacaatcttgtttcaatcacttattgagcgactgacaacttcaagccgtgaagaaaaatttagtgagttggaaaaagacacggattacgaatttcagaaacaactactagatatctctttatcagcgaaaaggagtttaatcggtgaatcgaagcttactcgttcagctatagcagctagatcagacataggtcctatccataatggaaggggatatatgctagtttttcaatccagatttcgaaagtttattaaactaccagtacttatagtcttgaaaaatatcggacgtattttactccgtcaaaattccgaatggaataaggactggacgggatggaagaaagaaattcatatcaattgtacgtttgatggcgaagacttttcacaagatgagttacctccacgatggttaagagaaggtattcagataaaaattgtgtatccgtttcaactgaagccttggcacacagatgggaatgaaaaacaacatactcttcaaagaaaacacaaagaaattggatctaaaagccgggaattgaaaagcaaaaggaaattgaagcaaaagaagcacaaatttacttatttaactgttttagggtatcagacggatataccttttggaactattcaaaagaaaacttctttttggaaacctgttcggagaaagttaattcggatttgtaaaagaagcttgcctcgtcaaattaaacaagcctatcaatttattcactctaggttcgagaaagtatcaaaattgaattcaactccatcgaagaaattgaatcttatttccaatctaagacaaggtggaaaattactaagtgactatagtctggatgagaaaagttggatgaaaacctcatctaccaattacgtaaatgaaaagacaaaacctaactgtaatgtaatttcaaacagtgagagatttattgctattggtggggaaatgagtccggctaatgttactcgtaaacaacttgttactcgggaccaggtagaaagagaatttttaatgagtatcgttgcagttgactccaaaaaccttttggacgaaaaaatagatgacccatattccaaaataacttcgaaggatttggaaacaggcgatactacatcaggtgacataaatcttgtgaattccaccaaatttgaacggaagcaattggtcgattccgaggaagcaggattaagtttatatttacttgtcagagaattaattgaaacatttgtttcagtactaataaacttgcctttcacaattaacaggatttttgttcattacttcactgaattcctcgcgttgtatacaaaattggcagggatattggataacattaatgagggaagcaatttatcaacaagaagtaaatcgttgcaatttgacttgccatctcaaacctgtatttatattgatatgtggaacatcggtatgaggggcagcttaaacctggatctgttagttaatgataaaagaagtagcagtaattgtggagtaaaaaatagacagagtggcatctatgttgaaaccgacggtgtatcaaacctatatcaacccaaaatgtacgagaaacaaactcccgtccattacaatttaatcgcgacaaaatttctgagtcctgaaataagaaataatcatgtaaatgatttaacaatgtgttttgatacggagactggcaaaactgatgaagagttttttgatgaaaaggttgcgaggtctatagagaattggggatttttgaataaatcttgcaaattggatgaaattaattggaatgaatggttatattctctctccagatataacttaccattaacagcctggcgcaatatagcacctcggaagtggaaagtttgcttgagtgaacttagtagtattgagacaaatacgataactgaattgaaagatcaggtatctcaaaacaagctacacagttattattccatatacacaaaaaaatctttcctcaggaataaaattagtaattttagtaaactgcgtaaacatagaaacctgctacaaaacctaactgattccgtacaaaatggcgatgtggaaaatttatctgtgcaacgagatattatggagcaaaggtttcattgcaagagttgcattcaaaaaagtagtagaggaggaagaaacagaattagcaaatttgttcactttctgagttctaatgtggagagcaaaaataatttgaatttgcaaattgatttgctatcgtggttagatccagatattgcaaaaacaaaaatatttttaaaaaaaaagaaaaaggcaaagcagttaaaaaatcctctattgagaaatcactaccgatacagatatgtattagacatatccggcagattccaaaaggtattgaatcagttgaatgatctcacgttagatgaaagagaagatgcggactacatttttcgatggaaatttaaatttgaaacagaattggaaaaatttagaaacttaatttctctcacgagaatgctaggagatgaccaagatttgattacactttgtacaaatattgaagtaaattcagatttgctaaatttgcaatttaatgcaaaaactaaacgtgatatgtttcataacttatctgttgtttcagcccatcgtttgcggctagtatttgacgatcaagatttgttgtataaaataatcaaccctttgctaaaattcaaagggagattaagaggtatatttaggagacgtttatacagaaatgtatataacggtagttatatttccaatttgtcacatatattaactgaacgaaattgtaaacagtcttgcctctataacatcgatgaccttttatctccgcgacgtaggcgggaatttcgatttctctattgtctattgagcccaaaaatagaatattcccaatatatatcaagaattaaaaaaatagacaatgctgagaaaaaacaaaccctttaccatctcccaagaccgatcaggattcaaaagattaaacgttttttatggcccagtcaccgattagaagaagcggcctgtacaggcagatcctgcgttggcgttatgactggaagtcgatttgtaacgcttagaatccgaatgtatcctattCCTCTAAATTAAAAAACCGGGTG

>chlN [prot=photochlorophyllide reductase subunit ChlN]
AATCTAAGGAAACACTTTTATGAAAACTCCGgagactcttgctttcgaatgtgaaaccggcaattaccatacgttctgcccaattagttgtgtagcttggttgtaccaaaaaattgaagatagttttttcctggtagtgggtacaaaaacttgtggttattttttgcaaaatgctcttggagtgatgatttttgccgaacctcgatatgcaatggcagaattggaagagggcgatatctcagctcagttaaatgatcagaaagagttggaaaagatttgcttacaaataagagacgataggaatcccagtgttatcatttggattggcacttgtactacagagataataaaaatggatttggaaggtatagcgccaaaattggaaaaacaaattggaatacctataatagttgcacgagcaaatggattggattacgccttcactcagggggaagataccgtgttggctgccatggcgcatcgctgtccggaatacaaacattgcacaacgaacttgaagaaccggactgatgaaatggcgcgtattgataatcatactactaacaaatctccctttgaagcgagtaaattgacaagattcaatttagtgctttttggttctttatcctccagtatagcttcgcaactgaatttagaattgaaacgccaatcaatttctgtttcaggttggttaccttcgcagaaatacgaggaactccccggcttaggagagggtatctatgtttgcggagtgaatccttttctgagtcgtacagcaacaacattaatgcgtcgccggaaatgtaagttagttggagcacctttcccaattggtccggatggcacacgcgcctggatcgaaaaaatttgttcagtttttgatattaagtcatacggtctagaaaatagggaaagtgaaatatgggaaaatgtcaaagattatatccaggtaataaatggtaaatccgtattctttatgggagataatttattggaaatttctttggcaagatttttaattcgatgcggaatgattgtttacgaagtaggaattccctatatggatagacgataccaagctgctgagcttttgtttttacaacatacttgccggaagatgaaaacacccctaccccggattgttgaaaaacccgacaattatggacagatacaacgtatgcatgagcttaaaccacatttggctattacgggaatggctcatgctaatcctttggaggctagaaatatagataccaaatggtcagttgaattcacatttgcacaaattcacggattcagtagcgttcgagacatcctcgaactagttactcgtccgctgcgacgtaggggtgttataaccccaggttttcgcagcttatcaaaacaaacgACAGGAGATTGATTAAATTTTTATTT

>chlL [prot=photochlorophyllide reductase subunit ChlL]
AATGAAAGTAGCAgtttatggaaaaggtggaattggaaaatcaacaactagctgtaatatatcgatagctttagccagaagaggaagaaaagtcttacaaattggatgtgacccaaaacatgatagtacatttacactaacaggatttttaatacctacaattatagatactttacaggtgaaagattaccactatgaagatgtatggcccgaagatgtgatttatagaggttacggcggggtagattgtgtagaagctggaggaccccctgcaggagcaggatgcggcgggtacgttgtgggagaaacggtaaaacttttgaaagaattaaatgctttttacgaatatgacatcattttattcgatgttctgggagatgttgtttgcgggggatttgccgctcccttaaattatgcggattattgcattattataactgataatggcttcgacgctctatttgcggcaaaccgtattgccgcttcagttagagaaaaatcacatacccatcccttgcgactagcgggtctagttggaaaccgaacatccggaagagatcttattgataaatatgtagaagcttgccccatgcctgtactagaggtattgcccttagtagaagatattcgcgtatcgagagtgaaaggaaaaaccttgtttgaaatggctgaatatcaaccgaatttaaattatgtttgtgatttttatttgaatatagcagatcaaatcttatccgagccagagggagtcgtgccaagggaaattccagatagagaattgtttagcttgctctctgatttttatttaaattccacctttacaaatgaaagtgatggtggatatgaccaccaagatgttccgcttgactttACAATTATTTGATGATGAA